|
| Status |
Public on Feb 15, 2008 |
| Title |
Cell_4 |
| Sample type |
other |
| |
|
| Source name |
Fourth embryonic neuronal single cell
|
| Organism |
Mus musculus |
| Characteristics |
Strain: OF1, Age : E14, Tissue : CGE
|
| Extracted molecule |
other |
| Extraction protocol |
CGE explants were dissected from embryonic mouse telencephalon and individual cells were dissociated in PBS
|
| Label |
Cy5
|
| Label protocol |
Single cell was peristaltically pumped and trapped into the microfluidic device. The cell was then mixed with 1X 1st strand synthesis buffer, 5mM DTT, 1mM dNTPs, 0.1% NP40, 1µM 3’ SMART CDS primer IIA (5’AAGCAGTG-GTATCAACGCAGAGTACT30VN-3’), 1µM template switching primer (5’AAGCAGTGGTATCAACGCAGAGTACGCGGG-3’) and 140U Rtases Reverse-iT Blend (ABgene) and incubated at 37°C for 25 minutes.
cDNAs were amplified in the presence of 1X Advantage® 2 polymerase (BD Clontech) and 1.25µM 5’PCR primer (AAGCAGTGGTATCAACGCAGAGT) by TS-PCR : 95°C for 2 minutes then 40 cycles 95°C for 15s, 65°C for 30s and 68°C for 6 minutes, in a conventional PCR machine (9700, Applera).
After purification using the Qiaquick PCR prurification kit (Qiagen), amplified cDNAs were labelled with 20µM dUTP-Cy5 (GE Healthcare) and 100mM random hexamers (GE Healthcare) in the presence of 50U Klenow fragment (Ozyme) overnight at 37°C.
|
| |
|
| Hybridization protocol |
RNG-MRC_MM25k_EVRY microarrays (Le brigand et al., NAR, 2006) were first incubated in a humid chamber for 2 hours to rehydrate the spots then placed for 1 hour in a dessicator and blocked for 1 hour at room temperature in 50mM Sodium Borate pH 9, 0.003% ethanolamine. Slides were then washed 5 minutes with water and dried by centrifugation.
Hybridizations were performed in 50% formamide, 5X Denhardt’s, 4x SSC and 0.1% SDS solution at 42°C for 16 hours. Microarrays were then washed at room temperature 5 minutes in 2X SSC, 0.1% SDS, 5 minutes in 1X SSC, 5 minutes in 0.2X SSC and 5 minutes in 0.05X SSC. Slides were finally dried by centrifugation 4 minutes at 900rpm.
|
| Scan protocol |
Microarray images were obtained using a ScanArray Gx scanner (Perkin Elmer) with laser power = 90% and PMT gain = 80%.
Median signal and median local background intensities were extracted from the images using Mapix v2.2.4 software (Innopsys).
|
| Description |
Fourth single cell analysis in the microfluidic rotary mixer.
|
| Data processing |
Intensity/background ratios were calculated for each spot in each experiment.
Features which were not interpretable in all the 4 single cells analyzed were excluded for further analysis. For comparing experiments, the sum of F/B values for each slide was then multiplied by a correcting factor so that the sum of the corrected ratios was equal in all experiments.
|
| |
|
| Submission date |
May 21, 2007 |
| Last update date |
Feb 08, 2008 |
| Contact name |
Luce Dauphinot |
| E-mail(s) |
luce.dauphinot@upmc.fr
|
| Phone |
33 1 57274518
|
| Organization name |
INSERM U1127-CNRS UMR7225-UPMC
|
| Department |
ICM
|
| Lab |
Alzheimer and Prions Disease team
|
| Street address |
47 boulevard de l'hôpital
|
| City |
Paris |
| ZIP/Postal code |
75013 |
| Country |
France |
| |
|
| Platform ID |
GPL4736 |
| Series (1) |
| GSE6941 |
Integrating whole transcriptome assays on a lab-on-a-chip for single cell gene profiling |
|
