GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1932278

Query DataSets for GSM1932278

Status

Public on Aug 24, 2016

Title

E08_MS02T23

Sample type

SRA

Source name

Cynomolgus monkey embryo E08

Organism

Macaca fascicularis

Characteristics

tissue: embryo
developmental stage: E08

Growth protocol

For cultivation on feeders, cyESCs were cultured with conventional hESC medium [DMEM/F12 supplemented with 20% (vol/vol) of KSR, 1 mM of sodium pyruvate, 2 mM of GlutaMax, 0.1 mM of non-essential amino acids, 0.1 mM of 2-mercaptoethanol, 1000 U/ml of ESGRO mouse LIF, and 4 ng/ml of recombinant human bFGF] on mouse embryonic feeders (MEFs).
For cultivation in feeder free condition, CMK6 was cultured using the same condition applied for human ESC/iPSC as reported previously [Nakagawa, M., et al. (2014). Scientific Reports, 4, 3594.]
The mouse ESC line BVSC R8 was cultured in a 2i+LIF, feeder-free culture condition as reported previously [Hayash, K., et al. (2011). Cell, 146, 519].
The mouse EpiLC was induced from 2i+LIF ESCs for two days in N2B27 medium containing activin A (20 ng/ml), bFGF (12 ng/ml), and KSR (1%) as reported previously [Hayash, K., et al. (2011). Cell, 146, 519].

Extracted molecule

total RNA

Extraction protocol

For single cell isolation from cy pre-implantation embryos, a whole embryo was incubated with 0.25% trypsin/PBS for around 10 min at 37℃, then dissociated into single cells by repeated pipetting, and dispersed in 0.1 mg/ml of PVA/PBS for preparation of single-cell cDNAs.
For single cell isolation from cy post-implantation embryos, the implantation site was dissected out from the uterus and the embryonic fragment containing the epiblast (EPI), amnion, hypoblast, and yolk sac endoderm was isolated manually. The fragment was incubated with 0.25% trypsin/PBS for around 10 min at 37℃, then dissociated into single cells by repeated pipetting, and dispersed in 0.1 mg/ml of PVA/PBS.
For single cell isolation from mouse E5.5 and E6.5 embryos, the embryos were dissected out from decidua and the extra-embryonic ectoderm was removed manually. The EPI/visceral endoderm (VE) were incubated in 0.25% Pancreatin/0.5 % Trypsin/Polyvinylpyrrolidone, and EPI and VE were separated by mild pipetting. For E5.5 embryos, EPI and VE were incubated with 0.25% trypsin/PBS separately for around 10 min at 37℃. For E6.5 EPI, their proximal parts were dissected out manually, and the proximal EPI and whole VE were incubated with 0.25% trypsin/PBS separately for around 10 min at 37℃. The proximal EPI and VE were dissociated into single cells by repeated pipetting, and dispersed in 0.1 mg/ml of PVA/PBS.
For single cell isolation from cyESCs, cells were first detached as clumps with CTK solution, incubated in 0.25% trypsin/PBS (Sigma-Aldrich) for around 10 min at 37℃, and dispersed into single cells in 1% (vol/vol) KSR/PBS containing 10 M of the ROCK inhibitor Y-27632. Cells under feeder-free condition were directly incubated in TrypLE Select for around 5 min at 37℃, and dispersed into single cells in 1% (vol/vol) KSR/PBS containing 10 M of the ROCK inhibitor Y-27632.
For single cell isolation from mESCs and EpiLCs, cells were incubated in TrypLE Select for around 5 min at 37℃, and dispersed into single cells in 1% (vol/vol) KSR/PBS.
For SC3-seq analysis, cDNA synthesis / amplification from single cells and library construction from the cDNAs were performed as described previously [Nakamura et al. 2015, NAR, 43, e60].

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

AB 5500xl Genetic Analyzer

Description

SC3-seq protocol
Single cell transcriptome of amplified cDNA from cynomolgus monkey embryo at E08
processed data file: SC3seq_Cy_ProcessedData.txt

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome mm10 or Macsca fascicularis genome Macaca_fascicularis_5.0 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—no-length-correction” and “—library-type fr-secondstrand” options and mm10 reference gene annotations with extended TTSs. We also set the cufflinks option “—max-mle-iterations” to 50,000, because default iterations (5,000) resulted in “FAILED” when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: mm10, Macaca_fascicularis_5.0
Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample ...

Submission date

Nov 06, 2015

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology