|
| Status |
Public on May 01, 2016 |
| Title |
Ser5P rep2 ChIP nexus |
| Sample type |
SRA |
| |
|
| Source name |
yeast BY4741, mid-exponential phase
|
| Organism |
Saccharomyces cerevisiae BY4741 |
| Characteristics |
strain: BY4741
genotype/variation: BY4741, rpb3::rpb3-3xFLAG NAT
|
| Growth protocol |
Yeast strains were grown in YPD at 30°C with shaking from an initial OD of 0.05 to mid-log phase with an OD of 0.6-0.8. For NET-seq in pSMF2 WT1-8 CTD and yKH303 T4V 1-8 CTD cells were grown at 30°C in sc-Lue media in the presense of 50 microgram per mL doxycylcine with shaking from an initial OD of 0.05 to mid-log phase with an OD of 0.6-0.8.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For NET-seq frozen cells were cryogenically pulverized for lysis and nascent RNA was isolated via an immunoprecipitation at 4°C of Rpb3-3xFLAG and purified using the miRNeasy kit (Qiagen, 217004). For ChIP-nexus cells were crosslinked in 1% formaldehyde, lysed by bead beating, and sonicated. Chomatin was isolated via immunoprecipitation using phospoh-CTD antibodies or TAP tagged subunits.
For NET-seq nascent immunoprecipitated RNA was fragmented by alkaline hydrolysis followed by size selection after electrophoresis on a polyacrylamide gel.RNA was treated with polynucleotide kinase (NEB) followed by ligation to a preadenylated RNA linker. The remainder of the library construction was done as described inte NET-seq library construction. All samples were sequenced using an Illumina NextSeq 500 in 75 base pair reads. For ChIP-nexus the library constrution was preformed as desribed in He, Q., Johnston, J., Zeitlinger, J. (2015) "ChIP-nexus enables improved detection of in vivo transcription factor binding footprints." Nature Biotechnology. Samples were sequenced on an Illumina MiSeq in 60 bp single end reads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
DNA isolated by ChIP against Ser5P
|
| Data processing |
Library strategy: ChIP-nexus
For NET-seq libraries were sequened in 76 base pair reads for all NextSeq libraires. For reads shorter than 75 basepairs respectively the adapter sequenice (ATCTCGTATGCCGTCTTCTGCTTG) was trimmed from the fastq files and files were filtered using PrinSeq version prinseq-lite-0.20.2 (http://prinseq.sourceforge.net). For ChIP-nexus reads were filtered for the presence of the fixed barcode CTGA, and for reads shorter than 60 basepairs the adapter sequence (AGATCGGAAGAGCACACGTCT) was trimmed.
For NET-seq the linker contained a molecular barcode with a random hexamer sequence. These random hexamers were removed using custom python scripts.For ChIP-nexus the remaining molecular barcode sequence was removed before alignment to the genome.
For NET-seq data were then aligned to the SacCer3 genome using the TopHat2 aligner v2.0.5 and reverse transcription mispriming events are identified and removed where molecular barcode sequences correspond exactly to the genomic sequence adjacent to the aligned read. For ChIP-nexus data were aligned to the sacCer3 genome using Bowtie version 1.1.1 .
For both NET-seq and ChIP-nexus only the 5' position of the read is recorded with a custom python script using HTSeq package in python . NET-seq data are stranded while ChIP-nexus contain strand data merged into a single file that is unstranded.
Genome_build: sacCer3
Supplementary_files_format_and_content: bedgraph: Chromosome, Start, End, Score
|
| |
|
| Submission date |
Dec 01, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Stirling Churchman |
| E-mail(s) |
churchman@genetics.med.harvard.edu
|
| Organization name |
Harvard Medical School
|
| Department |
Genetics
|
| Lab |
Churchman Lab
|
| Street address |
NRB Rm 356, 77 Ave Loius Pasteur
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL21372 |
| Series (1) |
| GSE68484 |
Native elongating transcript sequencing (NET-seq), nascnet RNA-seq, and total RNA-seq of wild type and RNA polymerase II C-terminal domain mutants and ChIP-nexus of RNA polymerase II C-terminal domains phosphoisoforms and splicing factors in S. cerevisiae |
|
| Relations |
| BioSample |
SAMN04305236 |
| SRA |
SRX1457814 |
