GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1978210

Query DataSets for GSM1978210

Status

Public on Oct 12, 2016

Title

E20_MS08T79

Sample type

SRA

Source name

Cynomolgus monkey embryo E20

Organism

Macaca fascicularis

Characteristics

subspecies: fascicularis
tissue: embryo
developmental stage: E20

Extracted molecule

total RNA

Extraction protocol

RNA preparation, cDNA synthesis and amplification from single cells were performed essentially as reported in Kurimoto, K.et al., Nucleic Acids Research, 34(5), e42.
Library constructions for SOLiD System were performed as reported in Nakamura et al., Nucleic Acids Res. (2015).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

AB 5500xl Genetic Analyzer

Description

Single cell transcriptome of amplified cDNA from cynomolgus monkey embryo at E20.
Long-tailed macaque (M. f. fascicularis) -- Brunei, Cambodia, Indonesia, Malaysia, Philippines, Singapore, Thailand, and Vietnam.
Processed data file: expression_RPM.txt

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the Cynomolgus monkey genome Macaca_fascicularis_5.0 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the "—no-coverage-search" option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the "—compatible-hits-norm", "—no-length-correction" and "—library-type fr-secondstrand" options and Macaca_fascucularis_5.0 reference gene annotations with extended TTSs. We also set the cufflinks option "—max-mle-iterations" to 50,000, because default iterations (5,000) resulted in "FAILED" when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: Macaca_fascicularis_5.0
Supplementary_files_format_and_content: expression_RPM.txt: Tab-delimited text file includes RPM values for each Sample.

Submission date

Dec 22, 2015

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology