 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 04, 2019 |
| Title |
E65 |
| Sample type |
SRA |
| |
|
| Source name |
E65, embryonic skin sample
|
| Organism |
Capra hircus |
| Characteristics |
tissue: skin
developmental stage: embryo
age: E65
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For small RNA-seq, the three skin samples at each developmental stage were mixed together, total RNA was extracted from the mixture. 3μg of each RNA sample was used for small RNA cDNA library preparation with Balancer NGS Library Preparation Kit for small/microRNA (GnomeGen, San Diego, CA, USA) based on manufacturer’s instruction. Briefly, RNAs were ligated to 3’ and 5’ adaptor sequentially, reverse transcribed to cDNA and PCR amplified. Whole library was applied to 10% native PAGE gel electrophoresis and bands corresponding to miRNA insertion were cut and eluted. After ethanol precipitation and washing, the purified small RNA libraries were quantified with Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA), used for cluster generation and applied to Illumina GAIIx (Illumina, San Diego, CA, USA) 73 nt single-end sequencing and Illumina NextSeq 500 151 nt pair-end sequencing according to the manufacturer’s instructions. The small RNA libraries sequencing was perfomed in ABLife, Inc. (Wuhan, China).
Total RNA was extracted by using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and RQ1 DNase (Promega, Madison, WI, USA) was used to remove contaminating genomic DNA. The quality and quantity of the purified RNA was monitored at the ratios of A260/A280 and A260/230 on SmartSpec Plus Spectrophotometer (BioRad, Philadelphia, PA, USA). RNA integrity was further verified by 1.5% agarose gel electrophoresis.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
The cashmere goat, which produces cashmere wool, is a breed of Capra hircus.
small RNA
expressed_miRNA_TPM.txt
|
| Data processing |
Illumina Casava1.9 software used for basecalling.
3' adapter (end1:TGGAATTCTCGGGTGCCAAGG;end2:GATCGTCGGACTGTAGAACTCTGAAC) trimmed with fastx_clipper
discovering novel miRNAs using miRDeep2,then predicting miRNA target gene using miRanda
mapped using bowtie -v 1
detecting different expression miRNA (TPM value) using Fisher test
Genome_build: Capra hircus CHIR_1.0
Supplementary_files_format_and_content: tab-delimited text file includes miRNA TPM values for each Sample.
|
| |
|
| Submission date |
Jan 05, 2016 |
| Last update date |
Nov 04, 2019 |
| Contact name |
Dong Chen |
| Organization name |
ABLife, Inc.
|
| Department |
Center for Genome Analysis
|
| Street address |
388 GaoXin 2nd Road, East Lake Hi-Tech Development Zone
|
| City |
Wuhan |
| State/province |
Hubei |
| ZIP/Postal code |
430075 |
| Country |
China |
| |
|
| Platform ID |
GPL21299 |
| Series (1) |
| GSE76538 |
Transcriptome profiling reveals transcriptional and alternative splicing regulation in the early embryonic development of hair follicles in the cashmere goat |
|
| Relations |
| BioSample |
SAMN04384527 |
| SRA |
SRX1517380 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
