GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2041663

Query DataSets for GSM2041663

Status

Public on Jan 20, 2016

Title

TS1471G_RNA-seq_MDBK_Mock + miR-17p3,4

Sample type

SRA

Source name

MDBK

Organism

Bos taurus

Characteristics

sample subseries: RNA-seq: BVDV vs. Mock
virus: Mock
small rna: miR-17p3,4
time point: 24hrs
index: GTGAAA

Extracted molecule

polyA RNA

Extraction protocol

Total RNA was isolated via Trizol extraction and DNAse treated.
RNA libraries were prepared for sequencing using standard Illumina protocols with polyA selection.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

Table S6.txt
D.Mock_miR-17p3,4_1

Data processing

AGO-CLIP data was processed as described (Moore et al. 2014 Nature Protocols). The deposited CLIP sequences are composed of (i) the index (3 OR 4 nts, see individual samples), (ii) the RL5 sequence (AGGGAGGACGAUGCGG), (iii) a 5N degenerate linker, (iv) the actual read sequence and, depending on read length (iv) a complete or partial RL3 sequence (GTGTCAGTCACTTCCAGCGGATCTCGTATGCCGTCTTCTGCTTG).
Processed reads were aligned to human (hg18) or bovine (BosTau7) host genomes as well as to viral genomes corresponding to the infecting agent using Bowtie or Novoalign (Novocraft). After all mapping, reads were collapsed on coordinates such that only those with sufficiently different degenerate linkers were kept; this distinguished unique binding events from PCR duplicates. For AGO-CLIP data, clustering of AGO-bound regions, annotation and calculations of log2 fold changes was done essentially as described (Luna et al. 2015 Cell). For annotation on cow, BosTau7 GTF annotation were downloaded from the USCS genome table browser and intersected with CLIP-derived clusters. CLIP data was based on 4 replicates per condition.
Quality filtered RNA-seq data were mapped to the cow (bosTau7) genome using Bowtie or Tophat2. The number of reads overlapping each gene (USCS Table Browser and Ensembl annotation) was counted with htseq-count. Expression data was processed essentially as described (Luna et al. 2015 Cell) using the edgeR and limma packages in R with general linear models. For MDBK cells, RNA-seq derived gene expression data was merged on gene name with AGO-CLIP data to allow CLIP-guided representation of changes to gene expression.
Changes to miRNA expression in quadruplicate libraries were calculated using edgeR for miRNAs represented in >=4 libraries, and adjusted p-values (FDRs) were presented.
Genome_build: hg18 or BosTau7
Supplementary_files_format_and_content: Table S1: Virus-aligned AGO-CLIP reads. A concatemerized list of all AGO-CLIP reads aligning to viral positive-strand RNA is given as a BED file. Two additional columns give experiment ID and notes for time course and cell type experiments.
Supplementary_files_format_and_content: Table S3: Abundance of AGO-loaded miRNAs in MDBK cells. The abundance of AGO-loaded miRNAs in MDBK cells is given by seed family. In addition, fraction of total for individual miRNAs is given for four replicates each of MDBK (mock) and MDBK (BVDV infected).
Supplementary_files_format_and_content: Table S4: Summarized AGO-CLIP analysis and related mRNA expression for BVDV and mock infected MDBK cells. The table summarizes AGO-CLIP clusters from analysis of BVDVcp vs. mock infected MDBK cells (four replicates each). For clusters in genic regions with a minimum total biologic complexity (BC) of 4, the peak height (PH) and BC for mock, BVDVcp and total are given. The normalized CLIP PH was calculated by addition of a pseudocount of 1 per condition and dividing by the total library size. The log2 fold change in AGO-CLIP binding was calculated directly from the normalized PH. Gene expression values corresponding to CLIP-defined clusters were calculated from mRNA-seq data in edgeR and logCPM (counts per million), log2 fold change and adjusted p-values (FDR) are given. Additional data include the genic region (CDS, UTR, intron) covering the largest fraction of each cluster, the cluster sequence, and the presence or absence of seed sites (6mer, 7merA1, 7merM8, 8mer) of the 50 most abundant miRNAs in MDBK cells.
Supplementary_files_format_and_content: Table S5: Summarized AGO-CLIP analysis for tinyLNA-17 and mock treated MDBK cells. The table summarizes AGO-CLIP clusters from analysis of tinyLNA-17 vs. mock treated MDBK cells (four replicates each). For clusters in genic regions with a minimum total biologic complexity (BC) of 4, the peak height (PH) and BC for mock, tinyLNA-17 and total are given. The normalized CLIP PH was calculated by addition of a pseudocount of 1 per condition and dividing by the total library size. The log2 fold change in AGO-CLIP binding was calculated directly from the normalized PH. Additional data include the cluster fraction mapping to each genic region (CDS, UTR, intron), the cluster sequence, and the presence or absence of seed sites (6mer, 7merA1, 7merM8, 8mer) of the 50 most abundant miRNAs in MDBK cells.
Supplementary_files_format_and_content: Table S6: Summarized mRNA expression analysis for BVDV and mock infected MDBK cells. The table summarizes RNA expression levels measured by mRNA-seq for mock, BVDVcp or BVDVncp infected MDBK cells, and for miR-17p3,4 transfected MDBK cells infected or not with BVDVcp-m17p3,4 or BVDVncp-m17p3,4. Gene expression values were calculated using general linear models in edgeR and logCPM (counts per million), log2 fold change and adjusted p-values (FDR) are given for pairwise comparisons.

Submission date

Jan 19, 2016

Last update date

May 15, 2019

Contact name

Troels K H Scheel

E-mail(s)

tscheel@sund.ku.dk

Organization name

University of Copenhagen

Department

Institute for Immunology and Microbiology