|
| Status |
Public on Sep 30, 2017 |
| Title |
Ctrl vs Stg VB_4 |
| Sample type |
RNA |
| |
|
| Channel 1 |
| Source name |
Ctrl Litter 4
|
| Organism |
Mus musculus |
| Characteristics |
tissue: VB
strain: C57BL/6
genotype/variation: control
strain: C57BL/6
|
| Treatment protocol |
P5-P6 mice were anesthetized on ice and decapitated, their brains were rapidly cut to 250 ìm thick slices using a vibratome (VT 1000S; Leica). The somatosensory cortex and VB were dissected out under a dissecting microscope from relevant sections and frozen on dry-ice
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs was extracted independently from each tissue sample and treated with DNAse1 using Nucleospin RNA II kit (Macherey-Nagel) according to the manufacturer’s instructions.
|
| Label |
Cy3
|
| Label protocol |
For the cortex, 5µg of total RNA were reverse-transcribed in the presence of 7.5µM random hexamers (GE Healthcare), 75µM aa-dUTP (Sigma-Aldrich) and 100U Rtases Reverse-iT Blend (ABgene) overnight at 37°C. Aminoallyl cDNAs were then labelled with Cy5 or Cy3 mono-Reactive Dye (GE Healthcare) according to the manufacturer’s instructions
For the VB, 500ng of total RNA was mixed with 1µM 3’ SMART CDS primer IIA (5’AAGCAGTG-GTATCAACGCAGAGTACT30VN-3’) and 1µM template switching primer (5’AAGCAGTGGTATCAACGCAGAGTACGCGGG-3’) and incubated at 70°C for 2 minutes. The following reagents were then added, 1X 1st strand synthesis buffer, 5mM DTT, 1mM dNTPs and 140U Rtases Reverse-iT Blend (ABgene), and the reaction incubated overnigth at 37°C. After the reverse-transcription was achieved, the cDNAs were amplified in the presence of 1X Advantage® 2 polymerase (BD Clontech) and 1.25µM 5’PCR primer (AAGCAGTGGTATCAACGCAGAGT) by TS-PCR: 95°C for 2 minutes then 14 cycles 95°C for 15s, 65°C for 30s and 68°C for 6 minutes. After purification using the Qiaquick PCR prurification kit (Qiagen), amplified cDNAs were labelled with 20µM dUTP-Cy5 or dUTP-Cy3 (GE Healthcare) and 100mM random hexamers (GE Healthcare) in the presence of 50U Klenow fragment (Ozyme) overnight at 37°C
|
| |
|
| Channel 2 |
| Source name |
Stg Litter 4
|
| Organism |
Mus musculus |
| Characteristics |
tissue: VB
genotype/variation: Stagerrer mutant
|
| Treatment protocol |
P5-P6 mice were anesthetized on ice and decapitated, their brains were rapidly cut to 250 ìm thick slices using a vibratome (VT 1000S; Leica). The somatosensory cortex and VB were dissected out under a dissecting microscope from relevant sections and frozen on dry-ice
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs was extracted independently from each tissue sample and treated with DNAse1 using Nucleospin RNA II kit (Macherey-Nagel) according to the manufacturer’s instructions.
|
| Label |
Cy5
|
| Label protocol |
For the cortex, 5µg of total RNA were reverse-transcribed in the presence of 7.5µM random hexamers (GE Healthcare), 75µM aa-dUTP (Sigma-Aldrich) and 100U Rtases Reverse-iT Blend (ABgene) overnight at 37°C. Aminoallyl cDNAs were then labelled with Cy5 or Cy3 mono-Reactive Dye (GE Healthcare) according to the manufacturer’s instructions
For the VB, 500ng of total RNA was mixed with 1µM 3’ SMART CDS primer IIA (5’AAGCAGTG-GTATCAACGCAGAGTACT30VN-3’) and 1µM template switching primer (5’AAGCAGTGGTATCAACGCAGAGTACGCGGG-3’) and incubated at 70°C for 2 minutes. The following reagents were then added, 1X 1st strand synthesis buffer, 5mM DTT, 1mM dNTPs and 140U Rtases Reverse-iT Blend (ABgene), and the reaction incubated overnigth at 37°C. After the reverse-transcription was achieved, the cDNAs were amplified in the presence of 1X Advantage® 2 polymerase (BD Clontech) and 1.25µM 5’PCR primer (AAGCAGTGGTATCAACGCAGAGT) by TS-PCR: 95°C for 2 minutes then 14 cycles 95°C for 15s, 65°C for 30s and 68°C for 6 minutes. After purification using the Qiaquick PCR prurification kit (Qiagen), amplified cDNAs were labelled with 20µM dUTP-Cy5 or dUTP-Cy3 (GE Healthcare) and 100mM random hexamers (GE Healthcare) in the presence of 50U Klenow fragment (Ozyme) overnight at 37°C
|
| |
|
| |
| Hybridization protocol |
Labeled cDNAs were purified on Qiaquick PCR purification kit (Qiagen) and hybridized to the RNG-MRC_MM25k_EVRY microarrays according to the RNG procedures
|
| Scan protocol |
Microarrays data were acquired on a GenePix 4000B Microarray Scanner ( Molecular Devices) with a resolution of 5 µm at wavelengths 532 and 635 nm
|
| Description |
Biological replicate 4 of 4
|
| Data processing |
Raw data were obtained with Genepix 4.1 software (Molecular Devices) . Processed data consisted of the Median Feature Intensity /Median Background Intensity (F/B ratio) ratio normalized by Lowess Fit
|
| |
|
| Submission date |
Apr 15, 2016 |
| Last update date |
Sep 30, 2017 |
| Contact name |
Luce Dauphinot |
| E-mail(s) |
luce.dauphinot@upmc.fr
|
| Phone |
33 1 57274518
|
| Organization name |
INSERM U1127-CNRS UMR7225-UPMC
|
| Department |
ICM
|
| Lab |
Alzheimer and Prions Disease team
|
| Street address |
47 boulevard de l'hôpital
|
| City |
Paris |
| ZIP/Postal code |
75013 |
| Country |
France |
| |
|
| Platform ID |
GPL4736 |
| Series (1) |
| GSE80317 |
RORα coordinates thalamic and cortical maturation to instruct barrel cortex development. |
|
