 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 19, 2016 |
| Title |
Group 11. FFPE of group 3 |
| Sample type |
SRA |
| |
|
| Source name |
prostate
|
| Organism |
Homo sapiens |
| Characteristics |
organ: prostate
status: tumor
source: primary tumor
storage: FFPE
|
| Treatment protocol |
n.a.
|
| Growth protocol |
Samples obtained by radical prostatectomy
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA Bee total RNA extraction
Illumina Small RNA Sample Preparation Guide, Part #1004239
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
carcinoma of the prostate
|
| Data processing |
CLC-Bio Genomics Workbench (v. 4.9)
Data Import using Illumina Genome Analyzer Single Read importer. Parameters: Quality score = Illumina Pipeline 1.3 and 1.4 Discard sequence names = Yes Discard quality scores = No
“Small RNA Analysis” workflow
Read-summarizing and adapter-removal parameters from the “Extract and Count” tool: Minimum sampling count: 4; Minimum and maximum number of nucleotides in reads: 15 and 35 nt, respectively; no 3’- or 5’- terminal nucleotide removal
Each read was screened with “no fixed adapter length” for the (partial) presence of Illumina small RNA adapter: CAAGCAGAAGACGGCATACGA on the minus strand with alignment mismatches and gaps allowance at a mismatch cost of 3, and a gap cost of 5, minimum score: ns, minimum score end: 3. If adapter was not found reads were discarded from further analysis
Filtered sequence reads were mapped to sncRNAdb with a maximum of 2 mismatches allowed using the “Annotate and Merge” tool
Boundaries of sdRNAs, tRFs and other sncRNA-derived RNAs (sncdRNAs) and specific location on the precursor sequence were done using Fragment Location Annotation and Identification Mapper (Hoogstrate Y et al., Bioinformatics. 2015; 31:665-673)
Genome_build: Custom sncRNAdb based on hg 19 (Hoogstrate Y et al., Bioinformatics. 2015; 31:665-673)
Supplementary_files_format_and_content: tab-delimited text file including raw and RPM values for each small RNA-derived RNA in each sample
|
| |
|
| Submission date |
Apr 18, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Elena Martens-Uzunova |
| E-mail(s) |
e.martens@erasmusmc.nl
|
| Organization name |
Erasmus MC
|
| Department |
Urology
|
| Street address |
Wytemaweg 80
|
| City |
Rotterdam |
| ZIP/Postal code |
3000CA |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL9052 |
| Series (1) |
| GSE80400 |
Small RNA sequencing of human prostate cancer samples |
|
| Relations |
| BioSample |
SAMN04867800 |
| SRA |
SRX1711828 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
