|
Status |
Public on Nov 16, 2016 |
Title |
Nibbler_KO_Ago3IP |
Sample type |
SRA |
|
|
Source name |
Ago3 bound small RNAs (18-40nt) from Nibbler -/- ovaries
|
Organism |
Drosophila melanogaster |
Characteristics |
age: 4-6 days old developmental stage: adult Sex: female knock-out or depletion: nibbler knock-out transgenic construct: -- rna fraction: Ago3 bound small RNAs tissue: ovary growth protocol: Flies were kept at strandard conditions at 25ยบ C.
|
Extracted molecule |
total RNA |
Extraction protocol |
total RNA was isolated with Trizol small RNAs were PAGE selected and 3' and 5' linkers was ligated. 1st strand cDNA synthesis was performed using SuperScript II (Invitrogen) and the library was amplified using the Kapa HiFi Library Amp real time Kit (Peqlab) with Illumina TruSeq compatible primers.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0) fastq files were adapter 'AGATCGGAAGAGCACACGTCT' clipped using cutadapt, version 1.0, default settings the first and last 4 bases were trimmed (both linkers contain 4 random nucleotides at their respective termini) reads were mapped with bowtie v0.12.7 to D. mel. genome (dm3, release 5) BigWig files were generated with Homertools v4.6 Genome_build: Drosophila melanogaster dm3, release 5.55 Supplementary_files_format_and_content: *depletion.txt: miRNA normalized read counts mapping to the plus and minus strand of the indicated sensor construct (1bp resolution) Supplementary_files_format_and_content: genome_mapping_read_counts.txt: table indicating read counts for all genome mapping small RNA sequences in the indicated libraries (0MM, Uextra excluded)
|
|
|
Submission date |
Jun 24, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Jakob Schnabl |
E-mail(s) |
jakob.schnabl@imba.oeaw.ac.at
|
Phone |
+43 1 79044 - 4522
|
Organization name |
IMBA - Institute of Molecular Biotechnology
|
Street address |
Dr. Bohr-Gasse 3
|
City |
Vienna |
State/province |
Vienna |
ZIP/Postal code |
1030 |
Country |
Austria |
|
|
Platform ID |
GPL17275 |
Series (1) |
GSE83698 |
Genetic and mechanistic diversity of piRNA 3' end formation |
|
Relations |
BioSample |
SAMN05291940 |
SRA |
SRX1874808 |