 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 30, 2017 |
| Title |
NETseq_Spt5_T4.5_I |
| Sample type |
SRA |
| |
|
| Source name |
NETseq_Spt5_T4.5
|
| Organism |
Schizosaccharomyces pombe |
| Characteristics |
strain: FWP487
genotype/variation: nmt81-Spt5-V5-IAA17_Rpb3-3xFLAG
treatment: thiamine + 1-Napthaleneacetic acid (NAA)
treatment time: 4.5 hr
experiment_number: 2
spike_in: S cerevisiae
rip antibody: anti-FLAG M2 Affinity gel (SIGMA, catalog #A2220)
demultiplex_code: TAGCTT
|
| Treatment protocol |
Spt5 depletion experiments were performed by adding NAA (0.5mM in DMSO, napthaleneacetic acid, Sigma, N0640) and thiamine (100nM, thiamine hydrochloride34, Sigma, T4625), to cells grown to a density of 10^7 cells/ml (O.D.600 ~ 0.5). Cultures were incubated with shaking at 30°C for 4.5 hours.
|
| Growth protocol |
S. pombe strains were grown in EMM complete media at 30°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
One liter cultures of S. pombe at 10^7 cells/ml were spiked-in with S. cerevisiae (10% by cell number), and the cells were collected by filtration. One of the libraries used for our analysis (T0_I, before depletion of Spt5) did not have S. cerevisiae as spike-in. Cells were flash frozen by forcing the cells through a syringe into liquid nitrogen. The frozen cells were mixed with 4 ml of frozen (by dropping 50 µl drops into liquid nitrogen) lysis-buffer without MnCl2 and protease inhibitors and lysed in a mixer-mill using 8 cycles at 15 Hz (Lysis buffer: 20mM HEPES, 110mM KOAc, 0.5% Triton X-100, 0.1% Tween 20, 10mM MnCl2, 1X protease inhibitors Roche EDTA-free). This lysate was thawed on ice and 1 ml lysis buffer with 50mM MnCl2 and 5x protease inhibitor, was added to the lysate along with 660 µl of DNAseI (RQ1, Promega) and incubated on ice for 30 minutes. Solubilized RNAPII was then immunoprecipitated along with the associated RNA using FLAG M2 Affinity gel (SIGMA), and eluted using 3X-FLAG peptide (SIGMA). RNA was extracted from the eluate using Qiagen miRNEasy kit.
Library prep was performed as previously described (PMID: 21248844) except that a modified linker-1 with a randomized hexamer was used for all libraries from experiment 2.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Strain_FWP487_genotype_nmt81-Spt5-V5-IAA17_Rpb3-3xFLAG
|
| Data processing |
Library strategy: NET-Seq
Experiment 1 (T0_I): Custom removal of adapter sequence (oLSC007: ATCTCGTATGCCGTCTTCTGCTTG).
Exp. 1: Filter-mapping against a "genome" of tRNA, rRNA, snRNA, and snoRNA to filter out noise that should not come down with Pol II via Bowtie1 with parameters -m1 (unique mapping) -n3 (allowing 3 mismatches) -e 120 (allowing three full mismatches) --max (dumping non-unique mappers in another file). Unmapped reads are kept for next step.
Exp. 1: Mapping to S. pombe genome using Bowtie1 with parameters -m1 -n3 -e 120.
Exp. 1: Remove all PCR duplicates from SAM via R: unique() (custom script) on concatenated strand, chr, position, and sequence.
Exp. 1: Remove all splicing intermediates (exon, intron 3' positions) and non-nuclear chromosomes via custom R script.
Exp. 1: Normalize to total remaining counts in library, produce WIG track file (custom R script).
Experiment 2 (T0_II, T4.5_I, T4.5_II): Cutadapt (1.8.3) removal of adapter sequence (oLSC007: ATCTCGTATGCCGTCTTCTGCTTG).
Exp. 2: Prinseq to clean file (-no_qual_header -min_len 7 -min_qual_mean 20 -trim_right 1 -trim_ns_right 1 -trim_qual_right 20 -trim_qual_type min -trim_qual_window 1 -trim_qual_step 1)
Exp. 2: Removal of hexameric molecular barcode via custom script. Placed in FASTQ header.
Exp. 2: Filter-mapping barcode-removed reads against a combined S. cerevisiae + S. pombe 'genome' composed only of t/r/sn/snoRNA using Tophat 2 with parameters --read-mismatches 3 --read-gap-length 1 --read-edit-dist 3 --min-anchor-length 8 --splice-mismatches 1 --min-intron-length 25 --max-intron-length 1200 --max-insertion-length 3 --max-deletion-length 3 --library-type fr-firststrand --segment-mismatches 3 --no-coverage-search --segment-length 25 --min-coverage-intron 50 --max-coverage-intron 100000 --min-segment-intron 50 --max-segment-intron 500000 --b2-sensitive.
Exp. 2: Mapping barcode-removed reads to combined S. pombe + S. cerevisiae 'genome' using Tophat 2 with same parameters as above plus the following to drive unique mapping: --prefilter-multihits --max-multihits 1 --transcriptome-max-hits 1
Exp. 2: Mapping barcode-containing reads (post-Prinseq input to barcode removal, above) using Tophat 2 with same parameters as barcode-removed immediately above. The purpose of this is to eventually filter out reads that map without barcode removal.
Exp. 2: From barcode-removed mapping, remove artefactual reads presumably arising from reverse transcription mispriming that map when the barcode is not removed. (Custom script).
Exp. 2: Remove all splicing intermediates and non-nuclear chromosomes via custom script.
Exp. 2: Split BAM into S. cerevisiae and S. pombe reads via custom script that calls bash samtools, grep, sed.
Exp. 2: Check whether spike-in normalization shows effect (it didn't: ratio of Sc/Sp similar in all samples). Custom script.
Exp. 2: Normalize to total remaining counts in library, produce WIG track file (custom R script).
Genome_build: Exp. 1: S. pombe ASM294v2; Exp. 2: S. pombe ASM294v2 concatenated to S. cerevisiae R64-1-1
Supplementary_files_format_and_content: WIG: track files of transcript 3' ends, from which RNA Pol II single-base-resolution active site position is inferred.
|
| |
|
| Submission date |
Aug 03, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Peter J Park |
| E-mail(s) |
peter_park@harvard.edu
|
| Phone |
617-432-7373
|
| Organization name |
Harvard Medical School
|
| Department |
Center for Biomedical Informatics
|
| Street address |
10 Shattuck St
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL13988 |
| Series (2) |
| GSE85124 |
Genome-wide analyses reveal widespread roles for Spt5 in sense and antisense transcription [NET-seq] |
| GSE85182 |
Genome-wide analyses reveal widespread roles for Spt5 in sense and antisense transcription |
|
| Relations |
| BioSample |
SAMN05507120 |
| SRA |
SRX1996842 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2258032_NETseq_Spt5_T4.5_I_minus_lib.wig.gz |
1.4 Mb |
(ftp)(http) |
WIG |
| GSM2258032_NETseq_Spt5_T4.5_I_plus_lib.wig.gz |
1.3 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
