|
| Status |
Public on Oct 25, 2017 |
| Title |
A1095: XY d39 age matched control gonad |
| Sample type |
SRA |
| |
|
| Source name |
embryonic gonad
|
| Organism |
Canis lupus familiaris |
| Characteristics |
tissue: embryonic gonad
developmental age: d39
sex chromosomes: XY
pedigree: Control
|
| Treatment protocol |
gonadal tissue was dissected from embryos and then flash frozen and stored in liquid nitrogen
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated with the RNeasy Plus Mini Kit (Qiagen)
Standard polyA+ RNAseq libraries were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) by the Cornell Biotechnology Resource Center Genomics Facility
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
A1095_XY_d39_Control
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.5 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 was used to map reads to the Dog CanFam3 reference genome, guided by the CanFam3 annotated transcriptome (Ensembl).
Novel transcripts were analyzed with cufflinks v2.2.1 (cufflinks, cuffmerge) guided by the CanFam3 annotated transcriptome (Ensembl). File: GuidedDiscovery_genes.gtf.gz
Transcripts were quantified with cuffquant v2.2.1 (-max-bundle-frags 5000000 to handle intervals with high read counts). Analyses included annotated genes only (CanFam3 gtf file with Amh added; --no-novel-juncs) and 'discovery' guided by annotated genes (cuffmerge output: GuidedDiscovery_genes.gtf.gz).
FPKM values were generated with cufflinks v2.2.1: cuffnorm was used for analysis of all samples in parallel for both annotated genes only (+Amh) and for the set of novel genes in GuidedDiscovery_genes.gtf.gz (guided by CanFam3 annotated genes); cuffdiff was used to call differentially expressed annotated genes for age-matched XX cohorts at d37 and d43.
Genome_build: CanFam3 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files generated with Cufflinks including FPKM values for all samples (Annotated_genes_FPKM.txt, GuidedDiscovery_genes_FPKM.txt) and differential gene expression analysis, including q-values reflecting multiple hypothesis testing correction, for age-matched XX cohorts at d37 and d43 (XX_d37_gene_exp.diff, XX_d43_gene_exp.diff).
|
| |
|
| Submission date |
Dec 12, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL21400 |
| Series (1) |
| GSE92283 |
Comparison of gene expression by RNA-seq in canine gonads from embryos at risk of XX Disorder of Sex Development (XX), male (XY) littermate controls, and age-matched female (XX) and male (XY) controls. |
|
| Relations |
| BioSample |
SAMN06132950 |
| SRA |
SRX2416451 |
