|
| Status |
Public on Oct 30, 2017 |
| Title |
P13 |
| Sample type |
SRA |
| |
|
| Source name |
meningioma
|
| Organism |
Canis lupus familiaris |
| Characteristics |
tumor grade: II
tumor subtype: atypical
|
| Treatment protocol |
All meningioma specimens were collected in 10% neutral buffered formalin and were embedded in paraffin wax within 24 hours of arrival at the New York State Animal Health Diagnostic Center (Cornell University College of Veterinary Medicine, Section of Anatomic Pathology). Diagnoses were made based on hematoxylin and eosin stained sections. Control samples of meninges were collected fresh from three healthy research beagle dogs shortly after euthanasia for an unrelated project.
|
| Growth protocol |
NA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was purified from 2x15uM scrolls from each FFPE block using the Agencourt FormaPure kit (Beckman Coulter) using a BioMek 4000 Automated Liquid Handling System (Beckman Coulter). For fresh-frozen control meninges samples, RNA was purified using Trizol (Invitrogen). Samples with high molecular weight material based on QC on an Fragment Analyzer (Advanced Analytical) were treated with RapidOUT DNAse (ThermoFisher Scientific). Ribosomal RNA was subtracted by hybridization from 1-2.5ug total RNA per sample using the RiboZero Magnetic Gold HMR Kit (Illumina).
Directional RNA-seq libraries were prepared from 50-100 ug rRNA-depleted RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the canine canFam3 reference genome+transcriptome (Ensembl).
cuffquant (--no-novel-juncs --library-type fr-firststrand) was used to quantify transcripts based on the canFam3 reference transcriptome (Ensembl).
cuffdiff v2.2.1 (--library-type fr-firststrand) was used to call differentially expressed genes based on the canFam3 reference transcriptome (Ensembl).
Genome_build: Canine canFam3 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
|
| |
|
| Submission date |
Feb 17, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL20988 |
| Series (1) |
| GSE95048 |
RNA-seq transcriptome analysis OF formalin-fixed paraffin-embedded canine meningioma |
|
| Relations |
| BioSample |
SAMN06346067 |
| SRA |
SRX2574457 |
