|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 24, 2017 |
Title |
ZUMA-0049-0050 |
Sample type |
SRA |
|
|
Source name |
6_PT
|
Organism |
Pan troglodytes |
Characteristics |
tissue: Blood
|
Extracted molecule |
genomic DNA |
Extraction protocol |
The method is based in the AUMA technique (Rodríguez, 2008; doi: 10.1093/nar/gkm1105), although important modifications were introduced to expand significantly the genomic coverage and to introduce internal controls that allow normalization and control of some technical biases. Briefly, one microgram of DNA was digested for 16 h at 25C with the methylation-sensitive restriction endonuclease SmaI (Roche Diagnostics GmH, Mannheim, Germany) leaving blunt ends (CCC/GGG), followed by a second digestion with the methylation-insensitive restriction enzyme MseI (T/TAA) (16h at 37C, Roche Diagnostics GmH, Mannheim, Germany) that leaves sticky ends. Adapters blunt-SmaI (ADPT-S1 GATAGTATGCCCGGGTGA plus the 5’ phosphorylated ADPT-S2 TCACCCGGGCATAC) and sticky-MseI (ADPT-M1 CTGAGGCTGGATCCCTG plus the 5’ phosphorylated ADPT-M2 TACAGGGATCCAGCCTCAG) were prepared by incubating the two oligonucleotides for 2 min at 65ºC and then cooling to room temperature for 30-60 min. Digested DNA and 2nmol of blunt and sticky adapters were ligated overnight at 16C using T4 DNA ligase (New England Biolabs, Beverly, MA). The product was purified using the Illustra GFX Purification kit (GE Healthcare, Buckinghamshire, UK) and eluted in 200 ul of bidistilled water. The ligation product consists of three types of molecules according to the flanking sites SmaI-SmaI, SmaI-MseI and MseI-MseI. Only the products containing SmaI adapters represent unmethylated fragments (Figure 1A). Next, a PCR (95ºC 2 min; 95ºC 30 sec, 60ºC 1 min, 72ºC 1min for 30 cycles; 72ºC 5min) was performed using two primers, one that anneals the MseI adapter (ADPT-M1A CTGAGGCTGGATCCCTGTAA) and another one homologous to the SmaI adapter plus TT at the 3’ end (ADPT-S1TT GATAGTATGCCCGGGTGAGGGTT) to enrich in Alu sequences. The final product appeared as a smear when run in an agarose gel and most of the amplicons ranged from 50 bp to 1000 bp. The NSUMA PCR product was sheared by sonication with a Bioruptor (Diagenode) to a size of 100-300 bp. DNA fragments were blunt end repaired with T4 DNA polymerase and Klenow fragment (NEB) and purified with a QIAquick PCR purification kit (Qiagen). Thereafter, 3’-adenylation was performed by incubation with dATP and the Klenow (3´→5´ exo-) fragment of DNA polymerase I (NEB). DNA was purified using MinElute spin columns (Qiagen) and ligated to double-stranded adapters (GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG/ACACTCTTTCCCTACACGACGCTCTTCCGATCT) using rapid T4 DNA ligase (NEB). The sample was purified again using a MinElute spin column and run on a 2% agarose gel, and fragments in the size range of interest, 150 bp plus 65 bp of adapters, were excised with a sterile single-use scalpel and recovered from the gel by QIAquick gel extraction. Then, adapter-ligated fragments were enriched, and adapters were extended, by selectively amplifying with an 18-cycle PCR reaction using Phusion DNA polymerase (Finnzymes), and primers 1.1 (5’ P- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and 2.0 (5’ P-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT) (library size of approximately 150 plus 92 bp of adapters). Finally, the quality of libraries was confirmed on the Agilent Technologies 2100 Bioanalyzer and by cloning into a blunt TOPO vector. Six colonies were sequenced by conventional Sanger method to verify correct adapter ligation and sequence match. Libraries were quantified by TaqMan Universal PCR No AmpErase kit (Applied Biosystems-Roche). DNA was loaded into a single read (SR) flow cell for cluster generation using a SR-cluster generation kit v4 (Illumina). During this process, DNA molecules were immobilized on the surface of the flow cell, amplified in situ to create same-sequence containing clusters, and following surface blocking and DNA denaturation, binding of sequencing primer was performed. The flow cell was then mounted on a Illumina Hi-Seq 2000instrument for sequencing, and 35-50 sequencing cycles were carried out using v4 SBS kits.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
Tests on paired end sequencing
|
Data processing |
NSUMA technique is described in (Jordà, 2017) PMID:27999094 Pre-processing. Sequences were obtained from the Illumina instruments as fastq Mapping. Paired-end reads were locally aligned against the hg19 canonocal chromosomes (22 autosomal, 2 sex) using bowtie2-2.2.6 with the -q --local --phred33 --sensitive-local --no-discordant --no-unal flags. Post-processing. Primary aligned reads from concordant pairs (unaligned and discordant pairs discarded during mapping) were assigned to the NSUMA canonical universe using featureCounts from subread-1.5.1 with the following flags: -F SAF -f -O -a slois_amplicons.saf –primary. Genome_build: hg19 Supplementary_files_format_and_content: fastq, read counts (text files)
|
|
|
Submission date |
Feb 23, 2017 |
Last update date |
May 15, 2019 |
Contact name |
Miguel A. Peinado |
E-mail(s) |
mpeinado@igtp.cat
|
Organization name |
IGTP
|
Street address |
Can Ruti Campus
|
City |
Badalona |
ZIP/Postal code |
08916 |
Country |
Spain |
|
|
Platform ID |
GPL16809 |
Series (1) |
GSE72877 |
The methylome of Alu repeats in primates |
|
Relations |
BioSample |
SAMN06436976 |
SRA |
SRX2752455 |
Supplementary file |
Size |
Download |
File type/resource |
GSM2505361_chimp_bowtie_counts_reads.txt.gz |
9.3 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
Processed data provided as supplementary file |
Raw data are available in SRA |
|
|
|
|
|