 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 01, 2018 |
| Title |
T7134_wt_mRNA_rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Tumor 7134 cell
|
| Organism |
Mus musculus |
| Characteristics |
genotype: WT
cell line: lymphoma cell line
|
| Treatment protocol |
Myc floxed allele was obtained from Douglas Green (St. Jude Children’s research hospital). Myc flox/flox mice (WT) or RosaCreERTam/Myc flox/flox mice (KO) were treated with tamoxifen (three times of i.p. 1mg/mouse at 4, 3 and 1 day before sacrifice). The deletion of floxed allele was checked by PCR or intracellular staining of Myc protein.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
ChIP-Seq: Cultured cells were fixed with 1% formaldehyde (Sigma) for 10’ at 37°C. Fixation was quenched by addition of glycine (Sigma) at a final concentration of 125 mM. Twenty million fixed cells were washed with PBS and resuspended in 1 ml of RIPA buffer (10 mM Tris [pH 7.6], 1 mM EDTA, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, 1× Complete Mini EDTA free proteinase inhibitor (Roche)) or stored at −80°C until further processing. Sonication was performed using Covaris S2 sonicator at duty cycle 20%, intensity 5, cycle/burst 200 for 30 min or Branson sonifier at amplitude 35%, 12 cycles of 20” sonication and 30” of pause. For native chip, chromatin was digested with Mnase (Sigma) in digestion buffer (50 mM Tris-HCl, pH7.6, 1 mM CaCl2, 0.2% Triton X-100, butyrate 5 mM) for 5’ at 37°C and dialyzed against RIPA buffer for 2hrs at 4°C. Five micrograms of antibody were incubated with 40 μl of Dynabeads Protein A (or G) for 40 min at room temperature. Antibody-bound beads were added to 500 μl of sonicated or Mnase-digested chromatin, incubated at 4°C overnight, and washed twice with RIPA buffer, twice with RIPA buffer containing 0.3M NaCl, twice with LiCl buffer (0.25 M LiCl, 0.5% Igepal-630, 0.5% sodium deoxycholate), once with TE (pH 8.0) plus 0.2% Triton X-100, and once with TE (pH 8.0). Crosslinking was reversed by incubating the beads at 65°C for 4 hr in the presence of 0.3% SDS and 1 mg/ml Proteinase K. ChIP DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. MNase-Seq: 4x107 resting and activated B cells were digested with 24 different concentrations of MnaseI. After an initial RT-qPCR analysis and curve-fitting, the MnaseI concentrations for the most representative nucleosomal fraction was determined. The lowest three nucleosomal fractions (which corresponded to MnaseI concentrations of 0U, 0U, and 0.0026U) were pooled together and used as input control. Nucleosomal fractions 16-18 (which corresponded to enzyme concentrations of 0.068U, 0.045U, and 0.03U) were also pooled for further processing. Input samples were sonicated to obtain similar fragment sizes as the MnaseI-digested samples. DNA was then concentrated and each sample was spiked with 0.055mg of l DNA (also sonicated to match the sample size as was input DNA).
HiC-Seq: we used the same protocol for in situ HiC libraries at Rao et al., (Cell, 2014 Dec; 159:1-16)
Gro-seq: Nuclei was extracted from 8-12 million cells grown on 10 cm plates and after run-on reaction the RNA was extracted with Trizol LS Reagent (Invitrogen, Carlsbad, CA, USA). RNA was treated with TURBO DNase (Ambion), fragmented using RNA Fragmentation Reagents (Ambion) and purified by running through P-30 column (Bio-Rad, Hercules, CA, USA). Fragmented RNA was dephosphorylated with PNK (New England Biolabs, Ipswich, MA, USA) followed by heatinactivation. Dephosphorylation reactions were purified using anti-BrdU beads (SantaCruz Biotech, Santa Cruz, CA, USA) and precipitated overnight. Poly(A)-tailing and cDNA synthesis was performed the next day as described in (Wang et al., 2011). However, for reverse transcription oligos with custom barcodes (underlined) were used : 5’-Phos CA/TG/AC/GT GATCGTCGGACTGTAGAACTCT /idSp/CAAGCAGAAGACGGCATACGA TTTTTTTTTTTTTTTTTTTTVN-3'. After cDNA synthesis, Exonuclease I (New England Biolabs; 30 min) was used to catalyze the removal of excess oligo. Enzyme was inactivated and RNA hydrolyzed by alkaline treatment (100 mM NaOH) and heat (25 min, 95°C). The cDNA fragments of were purified on a denaturing Novex 10% polyacrylamide TBE-urea gel (Invitrogen). The recovered cDNA was circularized, linearized, amplified for 10-14 cycles. The final product was ran on Novex 10%TBE gel, gel purified and cleaned-up using ChIP DNA clean & Concentrator Kit (Zymo Research Corporation, Irvine, CA, USA).
4C-seq: The 4C assay was performed as previously described van de Werken et al. (2012) with minor modifications. Ten million of CH12 B cell line were crosslinked in 2% formaldehyde at 37°C for 10 min. The reaction was quenched by the addition of glycine (final concentration of 0.125 M). Cells were then washed with cold PBS and lysed (10 mM Tris-HCl, pH 8.0, 10 mM NaCl, 0.2% NP-40, 1× complete protease inhibitors [Roche]) at 4°C for 1 hr. Nuclei were incubated at 65°C for 30 min, 37°C for 30 min in 500 μl of restriction buffer (New England BioLabs DpnII buffer) containing 0.3% SDS. To sequester SDS, Triton X-100 was then added to a final concentration of 1.8%. DNA digestion was performed with 400 U of DpnII (New England Biolabs) at 37°C overnight. After heat inactivation (65°C for 30 min), the reaction was diluted to a final volume of 7 ml with ligation buffer containing 100 U T4 DNA Ligase (Roche) and incubated at 16°C overnight. Samples were then treated with 500 μg Proteinase K (Ambion) and incubated overnight at 65°C to reverse formaldehyde crosslinking. DNA was then purified by phenol extraction and ethanol precipitation. For circularization, the ligation junctions were digested with Csp6I (Fermentas) at 37°C overnight. After enzyme inactivation and phenol extraction, the DNA was religated in a 7 ml volume (1,000 U T4 DNA Ligase, Roche). Three micrograms of 4C library DNA was amplified with Expand Long template PCR System (Roche). Thermal cycle conditions were DNA denaturing for 2 min at 94°C, followed by 30 cycles of 15 s at 94°C, 1 min at 58°C, 3 min at 68°C, and a final step of 7 min at 68°C. Bait was amplified with inverse PCR primers as follows: 3RR with DpnII:_4C 5'-GCTTATCTGTAAAGAATGGGTC-3', 3RR_Csp6i 5'-GGCCTTAGAAGGCTCTGTAC-3'. 4C-amplified DNA was microsequenced with the Illumina platform.
mRNA-seq: Total RNA from 106 of WT or ZF9-11 CH12 cells was isolated by Trizol extraction. mRNA was then isolated .
local Hi-C: 500ng of Hi-C library (8 cycles of amplification) was mixed with 2.5 µg of mouse Cot-1 DNA and 10µg of salomon sperm DNA in a total volume of 25µl. The sample was heated to 95℃ for 5 minutes. Next the temperature was diminished to 65℃ and the samples incubated for at least 5 minutes at 65℃. In the meantime 6µl of a RNA probe mixture (500ng of RNA probes, 20U of supreRNAseIn) and 33µl of hybridization buffer (10xSSPE, 10xDenhardt buffer, 10mM EDTA, 0.2% SDS) were incubated at 65℃. Next, the hybridization buffer and the RNA probe mixture were added to the sample. The final mix was incubated at 65℃ for 24 hours. Following the hybridization, 50 µl of MyOne Streptavidin T1 beads were washed 3 times with Bind-and-Wash buffer (1M NaCl, 10 mM Tris-HCl, pH=7.5, 1mM EDTA) and then resuspended in 134 µl of Bind-and-Wash buffer and added to the sample. The mixture was incubated for 30 minutes at room temperature with occasional swirling. Next, beads were separated using a magnet and the supernatant discarded. Beads were then washed once with 200µl of low-stringency buffer (1xSSC, 0.1%SDS) and incubated for 15 minutes at RT. Beads were separated and washed 3 times with high stringency.
ChromRNA-seq: chromatin RNA fraction was prepared from 3*10^6 cells following the method previously described (Pandya-Jones & Black, RNA, 2009) with some modifications. The pellet was lysed in a cytoplasm lysis buffer (20mM Hepes-KOH pH 7.6, 2mM MgCl2, 10% glycerol, 0.1% NP40, 0.5mM DTT with protease inhibitor, phosphatase inhibitor and RNase inhibitor). The lysate was then layered on top of a sucrose buffer in order to isolate the nuclei fraction from the cytoplasmic one (10mM Hepes-KOH pH7.6, 10mM NaCl, 1.5mM MgCl2, 10% glycerol, 0.5mM EDTA, 0.5mM DTT, 34% sucrose w/v with protease inhibitor, phosphatase inhibitor and RNase inhibitor).
ChromRNA-seq: The nuclei fraction was resuspended and lysed in a nuclear lysis buffer (10mM Hepes-KOH pH 7.6, 100mM NaCl, 0.5mM EDTA, 50% glycerol, 0.5mM DTT with protease inhibitor, phosphatase inhibitor and RNase inhibitor). Chromatin was precipitated by adding a Urea c
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Data processing |
base calling: illumina CASAVA 1.8.2
ChIP-Seq_density: alignment: bowtie-1.1.1/bowtie -S -m 1 -p 20 -a --best --strata -n 2 -l 50
ChIP-Seq_density: filtering (uniquely aligned reads): samtools-0.1.19-1.2/samtools view -S -b -F4
ChIP-Seq_density: normalized tag density: custom script, maximum 2 reads with the same start position allowed
Gro-Seq_density: alignment: bowtie-1.1.1/bowtie -S -m 1 -p 20 -a --best --strata -n 2 -l 50 --trim5 2
Gro-Seq_density: filtering (uniquely aligned reads): samtools-1.2/samtools view -S -b -F4
Gro-Seq_density: normalized tag density: bedtools-2.25/genomeCoverageBed -ibam -bg -split -scale normalization_factor -strand, ucsc-314/bedGraphToBigWig
mRNA-Seq_density:alignment: gsnap --use-sarray=0 --novelsplicing=0 --use-splicing refseq.splices.iit --format=sam -B 4
mRNA-Seq_density: filtering: samtools-1.2/samtools view -S -b -F132 -q 20
mRNA-Seq density: normalized tag density: bedtools-2.25/genomeCoverageBed -ibam -bg -split -scale normalization_factor, ucsc-314/bedGraphToBigWig
HiC-Seq: alignment: bwa-sw with default parameter (map each read separately)
HiC-Seq: filter: remove duplicates and near duplicates, removes reads that map to the same fragemnt and low quality reads (MAPQ <30)
HiC-Seq: generate contact matrix: juicer runnning with default parameter
4C-Seq: filtering: each read pair was tested for the presence of a perfect match to the respective bait primer as well as the bait spacer between the end of the primer and the restriction sites used in the corresponding experiment.
4C-Seq: mapping: bowtie-1.1.1/bowite -X 500 -p 3 -v2 -k2 -m1 --phred64-quals -sam
4C-Seq: frequency: assign to DPNII/CSP6i fragment to calculate fraction of restriction fragments for which 4C reads were found
ChIAPET: followed the process described in Li et al.,2010
ChIAPET: interaction call by chiapettool v2 program with default parameter
ChIA-PET: Chia-PET processing pipeline is described in greater detail in Li et al., 2010 (PMCID: PMC2872882)
local HiC: preprocess & normalization: juicer.sh using default parameter
local HiC: 5kb resolution matrices extraction: juicebox dump obsevered NONE .hic BP 5000
local HiC: R & custom script: generate genome wide contact matrix as in Sanborn et al. PNAS 2015
local HiC: estimation of number of in silico spike-ins: median of the genome-wide per-bin coverage of the local HiC matrix at the targeted region
local HiC: reconstruct HiC matrix: combine the targeted region local HiC with the global CH12 wt matrix which matched to spike-ins
local HiC: re-normalization: Knight-Ruiz balancing algorithm with the juicebox pre -r 5000
ChromRNA_density: alignment: bowtie-1.1.1/bowtie -S -m 1 -p 20 -a --best --strata -n 2 -l 50
ChromRNA_density: filtering (uniquely aligned reads): samtools-1.2/samtools view -S -b -F4
ChromRNA_density: normalized tag density: bedtools-2.25/genomeCoverageBed -ibam -bg -split -scale normalization_factor -strand, ucsc-314/bedGraphToBigWig
Genome_build: mm9
Supplementary_files_format_and_content:
ChIP-Seq: .wig files tag density in 100 nt windows divided by windowsize and library size in millions to obtain normalized read density (rpkm)
Gro-Seq: .wig files tag density divided by library size in millions to obtain normalized read density (rpkm)
HiC-Seq: .hic format including contact matrix, normalization information generated by juicer.sh
ChIAPET: bed12 format by editting the result of chiapettool by restricting to show only interactions having more than or equal to 3 PETs
4C-Seq: bed file showing read frequency in 100K window normalized by the number of fragments in each window
mRNA-Seq:.wig files tag density divided by library size in millions to obtain normalized read density (rpkm)
ChromRNA: strand-specific density tracks are generated by using bedtools genomecov program divided by library size in millions to obtain normalized read density (rpm)
|
| |
|
| Submission date |
Apr 24, 2017 |
| Last update date |
May 10, 2018 |
| Contact name |
Seolkyoung Jung |
| Organization name |
NIH
|
| Department |
NIAMS
|
| Lab |
biodata mining and discovery section
|
| Street address |
10 Center Dr
|
| City |
bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892 |
| Country |
USA |
| |
|
| Platform ID |
GPL21493 |
| Series (1) |
| GSE98119 |
The energetics and physiological impact of cohesin extrusion |
|
| Relations |
| BioSample |
SAMN06821379 |
| SRA |
SRX2755385 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2587484_T7134_wt_mRNA_rep3.bw |
97.6 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
