 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 22, 2017 |
| Title |
DFL_E12_Wt_H3K27ac |
| Sample type |
SRA |
| |
|
| Source name |
Distal Forelimbs
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Distal Forelimbs
genotype: wild type
strain: CD1
embryonic day: E12.5
antibody: anti-H3K27ac (abcam, ab4729)
|
| Growth protocol |
Heterozygous mutant mice were crossed in order to obtain Wt and homozygous mutant embryos.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
E12.5 limb tissue was micordissected from wild type or HoxD mutants embryos and used for ChIP experiments. Samples were fixed in 1% formaldehyde/PBS for 10 (CTCF, H3K27ac, RAD21) or 25 (RAD21, SMC1) minutes at room temperature, washed three times with cold PBS containing protease inhibitor (and, for H3K27ac, deacetylase inhibitor) and stored at -80°C. For ChIP-seq samples, around, one hundred milligrams of tissue were used. Nuclei were extracted by incubating them in a cell lysis buffer provided in the ChIP IT high sensitivity kit (Active motif) during at least 10 minutes and with the aid of a Dounce homogenizer type B (Active motif). The isolated nuclei were pelleted and lysed in sonication buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH=8.0, protease inhibitor and, for the case of H3K27ac, deacetylase inhibitor) for 10 min on ice, and fragmented to a range of 200-500 bp using a Vibracell tip sonicator or a Diagenode Bioruptor pico waterbath device. DNA concentration was estimated using the Qubit ds DNA HS assay kit following manufacturer instruction and 25-30ug of chromatin were diluted ten times in ChIP dilution buffer (20mM HEPES, 150mM NaCl, 0.1% NP40) and incubated overnight at 4ºC with 4ug of anti-CTCF antibody (Active motif, 61311, 61312), anti-SMC1 (Bethyl, A300-055A), anti-RAD21 (abcam, ab992) or 2ug of anti-H3K27ac (abcam, ab4729) on a rotating platform. For ChIP-seq samples, the next day chromatin-antibody complexes were incubated with protein A/G agarose beads during 3h at 4ºC and successively washed following manufacturer instructions. Finally they were eluted and purified by phenol:chlorophorm extraction and precipitation. Between 5 to 10ng of immunoprecipitated DNA were sequenced with a 50bp single-end Illumina HiSeq flow cell.
For ChIP-seq, 5-10 ng of purified DNA were used to make libraries according to the manufacturer’s protocol (Illumina). The material was sequenced with 50 bp single-end reads on the Illumine HiSeq according to the manufacturer’s specifications.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Distal forelimb mouse E12.5_Wt_H3K27ac_ChIP-seq
|
| Data processing |
adapters and bad quality bases were removed with cutadapt (ref Martin et al 2011 version 1.8 options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC for ChIP and -a CTGTCTCTTATACACATCTGACGCTGCCGACGA for ChIPmentation).
Then reads were mapped using bowtie2 on the mm10 genome (ref Langmead et al. 2012 version 2.2.4 default parameters).
Bam files were merged when replicates or resequencing were done.
The peaks and the coverage were obtained as the output of MACS2 (ref Zhang et al 2008 version 2.1.1.20160309 command line: macs2 callpeak -t input.bam --call-summits -B). By default, MACS2 only kept one tag at the same location (the same coordinates and the same strand), which would remove all potential contaminants from 4C experiments.
Genome_build: mm10
Supplementary_files_format_and_content: BedGraph contains the coverage from macs2
|
| |
|
| Submission date |
Jul 20, 2017 |
| Last update date |
Jan 25, 2022 |
| Contact name |
Eddie Rodríguez-Carballo |
| E-mail(s) |
edgardo.rodriguez@unige.ch
|
| Organization name |
Université de Genève
|
| Department |
Department of Genetics and Evolution
|
| Street address |
4, Boulevard d'Yvoy
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE101714 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes [ChIP-Seq] |
| GSE101717 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes |
|
| Relations |
| Reanalyzed by |
GSE166574 |
| Reanalyzed by |
GSM5828337 |
| Alternative to |
GSM5835470 |
| BioSample |
SAMN07374619 |
| SRA |
SRX3024488 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2713703_DFL_E12_Wt_H3K27ac.bedGraph.gz |
1.3 Gb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
