|
| Status |
Public on Dec 22, 2017 |
| Title |
Limbs_E12_del8-13rXII_RAD21 |
| Sample type |
SRA |
| |
|
| Source name |
Whole Forelimbs and Hindlimbs
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Whole Forelimbs and Hindlimbs
genotype: delHoxd(8-13)rXII
strain: B6CBAF1
embryonic day: E12.5
antibody: anti-RAD21 (abcam, ab992)
|
| Growth protocol |
Heterozygous mutant mice were crossed in order to obtain Wt and homozygous mutant embryos.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
E12.5 limb tissue was micordissected from wild type or HoxD mutants embryos and used for ChIP experiments. Samples were fixed in 1% formaldehyde/PBS for 10 (CTCF, H3K27ac, RAD21) or 25 (RAD21, SMC1) minutes at room temperature, washed three times with col
For ChIP-seq, 5-10 ng of purified DNA were used to make libraries according to the manufacturer’s protocol (Illumina). The material was sequenced with 50 bp single-end reads on the Illumine HiSeq according to the manufacturer’s specifications.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Whole forelimb and hindlimb mouse E12.5_del(8-13)rXII_RAD21_sequenced-twice_ChIP-seq
|
| Data processing |
adapters and bad quality bases were removed with cutadapt (ref Martin et al 2011 version 1.8 options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC for ChIP and -a CTGTCTCTTATACACATCTGACGCTGCCGACGA for ChIPmentation).
Then reads were mapped using bowtie2 on the mm10 genome (ref Langmead et al. 2012 version 2.2.4 default parameters).
Bam files were merged when replicates or resequencing were done.
The peaks and the coverage were obtained as the output of MACS2 (ref Zhang et al 2008 version 2.1.1.20160309 command line: macs2 callpeak -t input.bam --call-summits -B). By default, MACS2 only kept one tag at the same location (the same coordinates and the same strand), which would remove all potential contaminants from 4C experiments.
Genome_build: mm10
Supplementary_files_format_and_content: narrowPeak contains the peak calling; BedGraph contains the coverage from macs2
|
| |
|
| Submission date |
Jul 20, 2017 |
| Last update date |
Feb 19, 2020 |
| Contact name |
Eddie Rodríguez-Carballo |
| E-mail(s) |
edgardo.rodriguez@unige.ch
|
| Organization name |
Université de Genève
|
| Department |
Department of Genetics and Evolution
|
| Street address |
4, Boulevard d'Yvoy
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE101714 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes [ChIP-Seq] |
| GSE101717 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes |
|
| Relations |
| BioSample |
SAMN07374629 |
| SRA |
SRX3024500 |
