|
| Status |
Public on Dec 01, 2017 |
| Title |
pRbcS:miRGFP Shoot |
| Sample type |
SRA |
| |
|
| Source name |
Arabidopsis seedlings
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: shoot
age: 10 day-old seedlings
background: Col-0 (rdr6-15)
|
| Growth protocol |
Arabidopsis seedlings were grown at 22°C under long-day conditions in 1% agar plates containing 1x Murashige and Skoog (MS) medium supplemented with 1% sucrose.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from 10 day-old Arabidopsis seedlings using TRIzol reagent (Invitrogen). Small RNA libraries were prepared from 1 µg of total RNA. The 'No miRGFP' small RNA Libraries was constructed using the NEBNext Multiplex Small RNA Library Kit for Illumina (New England Biolabs). All the rest small RNA Libraries was constructed using the TruSeq Small RNA Library Kit from Illumina.
Small RNA Libraries prepared using standard Illumina protocols.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Isolated shoot sample from pRbcS:miRGFP seedlings expressing from the RbcS promoter, which is transcriptionally active in the mesophyll cells, an artificial miRNA (miRGFP) in the p35S:3xNLS-GFP rdr6 background.
|
| Data processing |
The RNA adapter AGATCGGAAGAGCACACGTCT for 'No miRGFP' Libraries and TGGAATTCTCGGGTGCCAAGG for all the rest of the Libraries were removed from the 3' end, using the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/).
For both Libraries trimmed reads 19- to 25-nt in length were selected.
Trimmed reads 19- to 25-nt in length were aligned to the Arabidopsis reference genome (TAIR10) including the eGFP coding sequence or the GUS coding sequence, using the Burrows-Wheeler Aligner, allowing for a single mismatch for miRGFP and 3 mismatches for the miRGUS to accommodate mismatches at the target sites of their GFP or GUS target sequence.
For comparison of small RNA levels across samples, read counts were normalized per million mapped reads (reads per million) using SAM Tools (Li, H. & Durbin, R., 2009).
Genome_build: Arabidopsis TAIR10 Build including the coding sequence of eGFP (atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggccatgatgagctttacaagtaa) or GUS (atggtccgtcctgtagaaaccccaacccgtgaaatcaaaaaactcgacggcctgtgggcattcagtctggatcgcgaaaactgtggaattgatcagcgttggtgggaaagcgcgttacaagaaagccgggcaattgctgtgccaggcagttttaacgatcagttcgccgatgcagatattcgtaattatgcgggcaacgtctggtatcagcgcgaagtctttataccgaaaggttgggcaggccagcgtatcgtgctgcgtttcgatgcggtcactcattacggcaaagtgtgggtcaataatcaggaagtgatggagcatcagggcggctatacgccatttgaagccgatgtcacgccgtatgttattgccgggaaaagtgtacgtatcaccgtttgtgtgaacaacgaactgaactggcagactatcccgccgggaatggtgattaccgacgaaaacggcaagaaaaagcagtcttacttccatgatttctttaactatgccggaatccatcgcagcgtaatgctctacaccacgccgaacacctgggtggacgatatcaccgtggtgacgcatgtcgcgcaagactgtaaccacgcgtctgttgactggcaggtggtggccaatggtgatgtcagcgttgaactgcgtgatgcggatcaacaggtggttgcaactggacaaggcactagcgggactttgcaagtggtgaatccgcacctctggcaaccgggtgaaggttatctctatgaactgtgcgtcacagccaaaagccagacagagtgtgatatctacccgcttcgcgtcggcatccggtcagtggcagtgaagggcgaacagttcctgattaaccacaaaccgttctactttactggctttggtcgtcatgaagatgcggacttacgtggcaaaggattcgataacgtgctgatggtgcacgaccacgcattaatggactggattggggccaactcctaccgtacctcgcattacccttacgctgaagagatgctcgactgggcagatgaacatggcatcgtggtgattgatgaaactgctgctgtcggctttaacctctctttaggcattggtttcgaagcgggcaacaagccgaaagaactgtacagcgaagaggcagtcaacggggaaactcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgacaaaaaccacccaagcgtggtgatgtggagtattgccaacgaaccggatacccgtccgcaaggtgcacgggaatatttcgcgccactggcggaagcaacgcgtaaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctgcgacgctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaaccgttattacggatggtatgtccaaagcggcgatttggaaacggcagagaaggtactggaaaaagaacttctggcctggcaggagaaactgcatcagccgattatcatcaccgaatacggcgtggatacgttagccgggctgcactcaatgtacaccgacatgtggagtgaagagtatcagtgtgcatggctggatatgtatcaccgcgtctttgatcgcgtcagcgccgtcgtcggtgaacaggtatggaatttcgccgattttgcgacctcgcaaggcatattgcgcgttggcggtaacaagaaagggatcttcactcgcgaccgcaaaccgaagtcggcggcttttctgctgcaaaaactggacgctggcatgaacttcggtgaaaaaccgcagcagggaggcaaacaataa).
Supplementary_files_format_and_content: tab-delimited txt file with normalized reads (rpm) for miRGFP (21nt) and the endogenous miR390 and miR156 for Libraries pCLV3:miRGFP, pSUC2:miRGFP and pRbcS:miRGFP. tab-delimited txt file with normalized reads (rpm) for miRGFP in shoot and root samples of pRbcS:miRGFP and "no miRGFP" control Libraries. tab-delimited txt file with normalized reads (rpm) for miRGUS (21nt) in p35S:miRGUS Library.
Supplementary_files_format_and_content: tdf format file generated with IGVtools for the processed p35S:miRGUS library alligned to Reference genome including the GUS sequence, showing no production of GUS-derived secondary siRNAs.
Supplementary_files_format_and_content: Reference genome including GUS sequence in Fasta format
|
| |
|
| Submission date |
Aug 03, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Marja Timmermans |
| E-mail(s) |
timmerma@cshl.edu
|
| Organization name |
Cold Spring Harbor Laboratory
|
| Department |
Plant Biology
|
| Lab |
Timmermans
|
| Street address |
One Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL13222 |
| Series (1) |
| GSE102236 |
miRNA mobility is a highly regulated process in plants |
|
| Relations |
| BioSample |
SAMN07447812 |
| SRA |
SRX3059330 |
