NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2741611 Query DataSets for GSM2741611
Status Public on Oct 12, 2017
Title Active-TBPT-rep3
Sample type SRA
 
Source name Melanocyte stem cells
Organism Mus musculus
Characteristics protocol: Active
tissue: Skin
age: Postnatal 10 weeks
genotype: TBPT
Treatment protocol Chemical Depilation or UVB irradiation
Growth protocol Mice were raised under standard conditions
Extracted molecule total RNA
Extraction protocol Cells were sorted through FACS, and total RNA was isolated using Trizol LS reagent
RNA-seq libraries were prepared from 500 ng total RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description gene_exp.diff: A_2
genes.read_group_tracking: A_2
Data processing Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--no-novel-juncs) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: Mouse mm10 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
 
Submission date Aug 13, 2017
Last update date May 15, 2019
Contact name Jennifer K Grenier
Organization name Cornell University
Department Biomedical Sciences
Lab Biotechnology Building rm 333
Street address 526 Campus Rd
City Ithaca
State/province NY
ZIP/Postal code 14853
Country USA
 
Platform ID GPL19057
Series (1)
GSE102597 Melanocyte Stem Cell Activation and Translocation Initiate Cutaneous Melanoma in Response to Ultraviolet Exposure
Relations
BioSample SAMN07502178
SRA SRX3090846

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap