|
| Status |
Public on May 11, 2018 |
| Title |
Male_Alb4C_Repl1_2pool_G118_M3 |
| Sample type |
SRA |
| |
|
| Source name |
Liver
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Liver
strain: Crl:CD1(ICR) (Charles River, strain code #022)
4c viewpoint: Albumin Promoter
Sex: Male
age: 8 weeks
pcr pool number: 2
|
| Growth protocol |
Male and female CD1 mice, 8-9 weeks of age, were purchased from Charles River Laboratories (Crl:CD1(ICR)).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Nuclei were isolated by ultracentrifugation in a high sucrose buffer then crosslinked with 0.8% formaldehyde for 9 minutes. This represents a pool of two independent PCR reactions.
Livers were harvested and sonicated according to two strategies indicated per sample. 10M Crosslinked nuclei were processed as described previously (van de Werken et al 2012, Splinter et al 2012). DpnII was used as the primary restriction enzyme and Csp6I was used as the secondary. All ligations and disgestions were overnight (minimum 16 hr), and were verified by running a small aliquot in a 1% agarose gel.
Samples were amplified for 25 cycles of inverse PCR using a custom primer pair containing sequence specific to the promoter of Albumin as well as a partial adaptor sequence to facilitate barcoding in a secondary PCR reaction. To reduce the impact of PCR domination, samples represent pools of 2 or 8 independent (but otherwise identical) inverse PCR reactions as indicated. The reading primer was anchored directly at the DpnII cutsite, while the nonreading primer was positioned ~75bp from the Csp6I site (Reading primer: ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTAAGTATGGTTAATGATC; Non-reading primer: GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTCTTTGTCTCCCATTTGAG). The samples were barcoded using New England Biolabs NEBNext Multiplex Oligos for Illumina (#E7335) with 5 rounds of additional PCR per the manufacturer's instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
4C-seq Library
|
| Data processing |
Library strategy: 4C-seq
READ FILTERING: Samples were sequenced 125bp paired end with additional viewpoints not included in this study. Read 1 of the raw fastq file (with multiple viewpoints) were filtered to select only sequences that contain the known Alb primers used: "TATGGTTAATGATC".
READ MAPPING: Reads were aligned using Burrows-Wheeler Alligner (Li and Durban 2009, Bioinformatics) allowing for up to 2 mismatches within the seed. Mapped reads were filtered to remove multiply-mapping reads as well as those mapping to Chromosome Y.
INTERACTION ANALYSIS: Near cis interactions were called per restriction fragment using an inverse power law background model from the software package R3Cseq (Thongjuea et al 2013, NAR). Trans interactions were determined for broad regions using 4Cker (Raviram et al 2016, PLoS Comp Bio) with the reccomended parameters (k=20).
Genome_build: mm9
Supplementary_files_format_and_content: Supplemental files were generated using R3Cseq (Thongjuea et al 2013, NAR) representing a read depth normalized (reads per million) 4C signal; bedgraph tracks were generated using R3Cseq representing interactions and with a score expressed as -10*log10(p value). The files are formatted for the WashU EpiGenome Browser in the "Long-Range" file format (http://wiki.wubrowse.org/Long-range).
|
| |
|
| Submission date |
Aug 23, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
David J. Waxman |
| E-mail(s) |
djw@bu.edu
|
| Organization name |
Boston University
|
| Department |
Department of Biology and Bioinformatics Program
|
| Street address |
5 Cummington Mall
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02215 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE102998 |
4C-seq analysis of interactions with the Albumin promoter in mouse liver |
| GSE102999 |
Computational prediction of CTCF/cohesin-based intra-TAD (sbTAD) loops that insulate chromatin contacts and gene expression in mouse liver |
|
| Relations |
| BioSample |
SAMN07548351 |
| SRA |
SRX3120284 |
