GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2779435

Query DataSets for GSM2779435

Status

Public on Sep 11, 2020

Title

Control at 7 days, rep 4 [CT_7D_REP4_ACTTGA]

Sample type

SRA

Source name

Control at 7 days_spinal cord

Organism

Gallus gallus

Characteristics

breed: Domestic chicken
genotype/variation: wild type
age: 7D
treated with: vehicle chemicals (sodium bitartrate monohydrate)
tissue: Spinal cord section

Biomaterial provider

Charles Ri ver Laboratories, Catskill, New York, USA

Treatment protocol

Nicotine (nicotine hydrogen bitartrate calculated as free base) and vehicle chemicals (sodium bitartrate monohydrate) were obtained from Sigma-Aldrich (St. Louis, Missouri, USA). Nicotine doses of 30 ng/ml and corresponding doses of vehicle control were calculated according to the weight of the egg. The injections were delivered from the blunt pole of the egg before incubation as described previously (Dalgic, Armagan et al. 2009). The drugs were dissolved in Chicken Ringer's solution and sterilized before injection using .22µm Millex® syringe filter units (Sigma-Aldrich, St. Louis, Missouri, USA).

Growth protocol

Two cohorts of 24 fertile specific pathogen-free eggs of the domestic chicken were obtained from Charles River Laboratories (Catskill, New York, USA). Eggs were randomly assigned to treatment and control cohorts.

Extracted molecule

total RNA

Extraction protocol

At the time point of sacrifice (5 or 7 days), egg shells were chipped off and the animals’ viability and proper development was verified. The verification of viability was based on observation of a heartbeat. Appropriate development and lack of gross abnormalities in animals were also verified (Hamburger and Hamilton 1951). Embryos (randomly selected 4 biological replicates for each treatment and time point) were harvested in RNAse- free conditions and dissected in cold DEPC-treated PBS. The section between the mid portion of the neck and posterior border of the anterior limb was cut out. A part of this section containing spinal cord was dissected using fine scissors, tweezers, and glass needles and then placed into a 1.5 ml tube filled with ice-cold DEPC-treated PBS. The samples were homogenized in TRI Reagent® or Trizol®(Sigma) and RNA extraction was completed using Ambion® PureLink® RNA Mini Kit (all reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA)). All RNA samples were stored at -80 °C before being shipped to Marshall University Genomics and Bioinformatics Core (GABC) where the expression analysis was conducted.
The RNA samples were sequenced (2 x 50 Paired End sequencing, 25 million reads per library) at Marshall University, WV, genomics core facility
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,, AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,,

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 1500

Description

CT_7D_REP4_ACTTGA

Data processing

The fastq read files were quality checked using using fastqc ver. 0.11.5 and 3-prime end trimmed for the Illumina TruSeq adapters and low quality bases (phred score < 20) using trimgalore ver. 0.4.4. The reads were then aligned to the Chicken genome (ensemblgenomes Gallus gallus ver. 5.0.88) using Hisat2 ver. 2.0.5 and bowtie2 ver. 2.3.2.
The aligned reads from each sample were then assembled using stringtie ver. 1.3.3b and the ensembl gene annotation file for Gallus gallus genome version 5.0.88. A second stringtie run was used to create merged assembly combining the individual sample assemblies.
Finally stringtie was again run using the merged assembly as the reference annotation.
A table of gene expression abundances for each sample was prepared using custom perl scripts. Differential expression analysis was done using the DESeq2 package in R ver 3.3.1.
The time, nicotine treatment, and the time:nicotine interaction variables were included in the DESeq2's model. Differential expression comparisons were made for the effect of time, effect of nicotine and the interaction effect of nicotine and time. Genes with a multiple testing adjusted p-value cutoff of < 0.05 were considered as significant.
Genome_build: ensemblgenomes Gallus gallus ver. 5.0.88
Supplementary_files_format_and_content: gene expression abundances for each sample (*.matrix); CSV format of Processed results for DESeq2 differential expression (*.all.csv).

Submission date

Sep 11, 2017

Last update date

Sep 11, 2020

Contact name

Sridhar A Malkaram

E-mail(s)

smalkaram@wvstateu.edu

Organization name

West Virginia State University

Department

Mathematics and Computer Sciences