|
| Status |
Public on Jan 18, 2018 |
| Title |
sec63BirA_srp72-AID_auxin30_2minCHX_2minBiotin_input |
| Sample type |
SRA |
| |
|
| Source name |
S288C
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
genotype: srp72::srp72-AID-HA::LEU2 sec63::SEC63-mVenus-BirA::HIS5 rpl16a::RPL16a-HA-TEV-AVI rpl16b::RPL16b-HA-TEV-AVI his3::OsTIR1-V5::URA3 leu2-delta-0 met15-delta-0 ura3-delta-0
|
| Treatment protocol |
Cells were treated with 500 µM auxin for indicated times. For harvesting, where indicated, cells were treated with 100 µg/ml cycloheximide for 2 minutes prior to biotin induction with 10 nM biotin for the times shown.
|
| Growth protocol |
Yeast cells were grown in SD media containing 0.125 ng/ml D-biotin to OD600 .4-.6.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Yeast cells were harvested by filtration, flash frozen, and cryogenically pulverized in a Retsch mixer-mill.
Footprinting was performed with RNase I, monosomes purified on 10-50% sucrose gradients and biotinylated ribosomes purified on streptavidin dynabeads. RNA was extracted with trizol and protected fragments gel purified. Ends were repaired with T4 PNK and ligated to a pre-adenylated linker with T4 RNA Ligase 2. In samples with sample barcode, pre-adenylated linker contained 5 nt UMI and 4 nt sample barcode. Unligated linkers were enzymatically removed and ligated fragments were gel purified, reverse transcribed and gel purified. The cDNA was circularized then PCR amplified.
OTHER (ribosome profiling)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Ribosome protected mRNA fragment. Sample barcode: CGAT
|
| Data processing |
Base calls were called with Illumina CASAVA software
3' adaptor was trimmed using fastx_clipper with -l 24 (samples with barcode: -a AGATCGGAAGAGCACACGTCTGAACTC; samples without barcode: -a CTGTAGGCACCATCAAT
5' nucleotide was removed using fastx_trimmer -f 2
For samples with barcoded linker, barcodes were separated with fastx_barcode_splitter. The UMI (5 nt) and barcode (4 nt) were then removed from the 3' end of read using a custom script
Reads were aligned to rRNA, tRNA and cloning oligos using Bowtie v1.1.2. Unaligned (filtered) reads were aligned to a genomic index (sacCer3) using Tophat v2.1.1 with the following parameters: --bowtie1 --read-mismatches 0 --no-novel-juncs. Only uniquely-mapped reads were used for subsequent analysis.
Each alignment was assigned a specific P-site nucleotide using a 15 nt offset from the 3' end of the read. Gene level counts and rpkm were calculated using plastid cs count using a positions file that masks regions to which reads cannot uniquely align. For rpkm calculations, all reads mapping to any annotated exon (transcipt) were used for the denominator for total reads mapped.
Genome_build: sacCer3
Supplementary_files_format_and_content: Tab delimited file containing count and rpkm data
|
| |
|
| Submission date |
Oct 30, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Jonathan S Weissman |
| Organization name |
Whitehead Institute for Biomedical Research, MIT
|
| Department |
HHMI, Biology
|
| Lab |
Weissman
|
| Street address |
455 Main St
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL21656 |
| Series (1) |
| GSE106329 |
Defining the physiological role of SRP in protein-targeting efficiency and specificity |
|
| Relations |
| BioSample |
SAMN07947867 |
| SRA |
SRX3343234 |
