NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2838910 Query DataSets for GSM2838910
Status Public on Jun 21, 2018
Title B05_r2
Sample type SRA
 
Source name macrophage
Organism Mus musculus
Characteristics time point: 5
Extracted molecule total RNA
Extraction protocol Macrophages were isolated from inert conduits 5, 14 and 28 days after sciatic transection by flow cytometry (Lin-F4/80+CD14+CD11b+CD16/32+). Total RNA was isolated with the Quick-RNA MicroPrep kit (Zymo Research).
RNA-seq libraries were prepared from 25 ng total RNA using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description response to nerve repair
B05_1
Data processing Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--no-novel-juncs) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: Mouse mm10 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
 
Submission date Nov 03, 2017
Last update date May 15, 2019
Contact name Jennifer K Grenier
Organization name Cornell University
Department Biomedical Sciences
Lab Biotechnology Building rm 333
Street address 526 Campus Rd
City Ithaca
State/province NY
ZIP/Postal code 14853
Country USA
 
Platform ID GPL19057
Series (1)
GSE106488 Temporal Changes in Macrophage Phenotype after Peripheral Nerve Injury
Relations
BioSample SAMN07974967
SRA SRX3359241

Supplementary data files not provided
SRA Run SelectorHelp
Processed data are available on Series record
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap