|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Nov 19, 2018 |
Title |
Sample_P16 |
Sample type |
SRA |
|
|
Source name |
Placenta
|
Organism |
Equus caballus |
Characteristics |
tissue: chorioallantoic membrane
|
Treatment protocol |
Mares were bred via either pasture breeding or artificial insemination, with pregnancy confirmed by transrectal ultrasonography between 14 to 35 days of gestation. Gestational age was determined by date of ovulation if known, otherwise, the size and morphology of the embryo was used
|
Extracted molecule |
total RNA |
Extraction protocol |
Isolation of RNA from tissue was performed using RNeasy Mini Kit (Qiagen, Gaithersburg, MD, USA), per manufacturer’s instructions. After extraction, RNA was analyzed by NanoDrop® (Thermo Fisher Scientific) and Bioanalyzer® (Agilent, Santa Clara, CA, USA) to evaluate concentration, purity and integrity. All samples had a 230/260 ratio > 1.8, a 260/280 ratio > 2.0 and an RNA integrity number > 8.0. Library preparation was performed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina), as per manufacturer’s instructions. The adapter for Read 1 was AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG, with NNNNNN signifying the index sequence. The read 2 adapter was AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT. All reads were quantified with qPCR. Sequencing was performed on a HiSeq 4000 (Illumina) using a HiSeq 4000 sequencing kit version 1, generating 150 bp paired-end reads. FASTQ files were generated and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 4000 |
|
|
Data processing |
The sequencing results were initially trimmed for adapters and quality using TrimGalore Version 0.4.4 (Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk). The sequences were mapped to EquCab2.0 using STAR-2.5.2b (github.com/alexdobin/STAR). Final quantification at the gen level was performed by analyzing the BAM files in cufflinks using the Equus_caballus_ENSEMBL_88 gtf file as Guide. Genome_build: EquCab2.0 Supplementary_files_format_and_content: normalized abundance measurements- Cufflink Gene.FPKM.Tracking
|
|
|
Submission date |
Dec 19, 2017 |
Last update date |
Nov 19, 2018 |
Contact name |
Shavahn C Loux |
E-mail(s) |
Shavahn.Loux@uky.edu
|
Organization name |
University of Kentucky
|
Department |
Veterinary Science
|
Street address |
1400 Nicholasville
|
City |
Lexington |
State/province |
KY |
ZIP/Postal code |
40546 |
Country |
USA |
|
|
Platform ID |
GPL24409 |
Series (1) |
GSE108279 |
Evaluation of mRNA expression in the equine chorioallantoic membrane |
|
Relations |
BioSample |
SAMN08204703 |
SRA |
SRX3485254 |
Supplementary file |
Size |
Download |
File type/resource |
GSM2894538_Sample_P16-genes.fpkm_tracking.gz |
726.6 Kb |
(ftp)(http) |
FPKM_TRACKING |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|