|
Status |
Public on Jun 14, 2018 |
Title |
Virtual memory CD8 cells timestamped at day 1, rep 1 |
Sample type |
SRA |
|
|
Source name |
CD4-CD8+CD44hi TdTomato+ sorted cells
|
Organism |
Mus musculus |
Characteristics |
strain/background: C57BL/6 transgenic insertions: gBT-I, Ai9, CD4cre-ERT2 timestamp age: 1 day age at collection: 4 weeks tissue: spleen cell type: CD4-CD8+CD44hi TdTomato+ sorted cells
|
Treatment protocol |
To mark cell with TdTomato at specific times during development, mice were given tamoxifen at 1 day (through lactation, by administering tamoxifen orally to the Dam) or at 28 days of age (by direct oral administration to the mouse). The mice were then aged to allow for the same amount of post-thymic maturation (4 weeks).
|
Growth protocol |
CD4cre-ERT2 mice were crossed to Ai9 mice bearing a floxed-stop TdTomato element such that when F1 offspring are exposed to tamoxifen, all cells bearing CD4 will begin expressing TdTomato for the duration of tamoxifen exposure.
|
Extracted molecule |
total RNA |
Extraction protocol |
CD8+ cells were magnetically enriched with CD8 microbeads and sorted to > 95% purity with a FACS Aria III on CD4- CD8+ TdTomato+ CD44 hi (virtual memory) or lo (true naïve) populations. Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. Directional RNA-seq libraries were prepared from total RNA isolated from 10,000 cells (~10-20ng) using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
TgVirtualMemory_1dayTimestampA Virtual memory cells made (Td-Tomato stamped) at 1 day. gene_exp.diff: 1dMP genes.read_group_tracking.txt: 1dMP_0
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC). cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC). Genome_build: mm10 (UCSC) Supplementary_files_format_and_content: Tab-delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates, as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Jan 28, 2018 |
Last update date |
Jun 14, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (2) |
GSE97802 |
The fate of CD8+ T cells during infection is linked to their developmental origin |
GSE109753 |
The fate of CD8+ T cells during infection is linked to their developmental origin [VirtualMemory_and_TrueNaïve_timestamp] |
|
Relations |
BioSample |
SAMN08426442 |
SRA |
SRX3605701 |