 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 13, 2018 |
| Title |
Mock,Raltegravir-1 |
| Sample type |
SRA |
| |
|
| Source name |
Corneal epithelial cells
|
| Organism |
Felis catus |
| Characteristics |
cell source: Liberty Research cat primary isolation
virus status: Non-infected
treatment: 500 uM Raltegravir
|
| Treatment protocol |
For analysis of infected samples- 300,000 cells were plated in T25s and grown 2 days. Cells were serum starved in 2% FBS media for 6 hours, infected with FHV-1 MOI=10, grown 2 hours, rinsed with PBS to remove virus, and then treated with 500 uM Raltegravir or DMSO. Cells were collected 2 h later (4 hpi). For analysis of uninfected samples- 300,000 cells were plated in T25s and grown 2 days. Cells were serum starved in 2% FBS media for 6 hours, treated with 500 uM raltegravir or DMSO, grown for 2 h, and then collected
|
| Growth protocol |
Primary corneal epithelial cells were isolated from a healthy SPF free cat and maintained in DMEM/F12 supplemented with 10% FBS, 100 U/ml penicillin, 100 ug/ml stretomycin, 2 mM L-glutamine, 0.1 ug/ml cholera toxin, 10 ng/ml human recombinant epithelial growth factor, 1 ug/ml hydrocortisone, and 5 ug/ml recombinant human insulin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed using trizol, lysates were frozen, and total RNA was isolated using the manufacturer's protocol.
Diretional RNA-seq libraries were prepared from 1 ug total RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
MockVsRalt_gene_exp.diff: C3_0
MockVsRalt_genes.read_group_tracking: C3_0
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--library-type fr-firststrand) was used to map reads to the Felis catus 6.2 reference genome+transcriptome (Ensembl).
cufflinks and cuffmerge were used to generate a project-specific transcriptome guided by the Felis catus 6.2 reference genome+transcriptome (Ensembl).
cuffquant (--library-type fr-firststrand) was used to quantify transcripts guided by the Felis catus 6.2 reference genome+transcriptome (Ensembl).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the Felis catus 6.2 reference genome+transcriptome (Ensembl).
Genome_build: Felis_catus_6.2 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
| |
|
| Submission date |
Jan 29, 2018 |
| Last update date |
Jun 13, 2018 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL24552 |
| Series (1) |
| GSE109806 |
Transcriptome profiling of alphaherpesvirus-infected cells treated with the HIV-integrase inhibitor raltegravir reveals profound and specific alterations in host transcription. |
|
| Relations |
| BioSample |
SAMN08432509 |
| SRA |
SRX3626702 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
