|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jun 13, 2018 |
Title |
Mock,Raltegravir-1 |
Sample type |
SRA |
|
|
Source name |
Corneal epithelial cells
|
Organism |
Felis catus |
Characteristics |
cell source: Liberty Research cat primary isolation virus status: Non-infected treatment: 500 uM Raltegravir
|
Treatment protocol |
For analysis of infected samples- 300,000 cells were plated in T25s and grown 2 days. Cells were serum starved in 2% FBS media for 6 hours, infected with FHV-1 MOI=10, grown 2 hours, rinsed with PBS to remove virus, and then treated with 500 uM Raltegravir or DMSO. Cells were collected 2 h later (4 hpi). For analysis of uninfected samples- 300,000 cells were plated in T25s and grown 2 days. Cells were serum starved in 2% FBS media for 6 hours, treated with 500 uM raltegravir or DMSO, grown for 2 h, and then collected
|
Growth protocol |
Primary corneal epithelial cells were isolated from a healthy SPF free cat and maintained in DMEM/F12 supplemented with 10% FBS, 100 U/ml penicillin, 100 ug/ml stretomycin, 2 mM L-glutamine, 0.1 ug/ml cholera toxin, 10 ng/ml human recombinant epithelial growth factor, 1 ug/ml hydrocortisone, and 5 ug/ml recombinant human insulin
|
Extracted molecule |
total RNA |
Extraction protocol |
Cells were lysed using trizol, lysates were frozen, and total RNA was isolated using the manufacturer's protocol. Diretional RNA-seq libraries were prepared from 1 ug total RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
MockVsRalt_gene_exp.diff: C3_0 MockVsRalt_genes.read_group_tracking: C3_0
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.0.13 (--library-type fr-firststrand) was used to map reads to the Felis catus 6.2 reference genome+transcriptome (Ensembl). cufflinks and cuffmerge were used to generate a project-specific transcriptome guided by the Felis catus 6.2 reference genome+transcriptome (Ensembl). cuffquant (--library-type fr-firststrand) was used to quantify transcripts guided by the Felis catus 6.2 reference genome+transcriptome (Ensembl). cuffdiff v2.2.1 was used to call differentially expressed genes based on the Felis catus 6.2 reference genome+transcriptome (Ensembl). Genome_build: Felis_catus_6.2 (Ensembl) Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Jan 29, 2018 |
Last update date |
Jun 13, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL24552 |
Series (1) |
GSE109806 |
Transcriptome profiling of alphaherpesvirus-infected cells treated with the HIV-integrase inhibitor raltegravir reveals profound and specific alterations in host transcription. |
|
Relations |
BioSample |
SAMN08432509 |
SRA |
SRX3626702 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|