NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2991324 Query DataSets for GSM2991324
Status Public on Jul 31, 2018
Title Stage 2 rep2 [ncRNA]
Sample type SRA
 
Source name oviduct luminal fluid
Organism Bos taurus
Characteristics tissue: oviduct luminal fluid
estrous cycle stage: early luteal phase, days 5-11
Growth protocol EVs were isolated by ultracentrifugation (Théry et al., 2006; Almiñana et al., 2017). First, flushing samples were centrifuged at 300 g for 15 min, followed by 2,000 g for 15 min, and then at 12,000 g for 15 min to remove cells, blood, and cell debris and ultracentrifuged twice at 100,000 g for 90 min (BECKMAN L8-M; SW41T1 rotor) to pellet EVs. The pellets were resuspended in 50 µL of PBS and stored at -80ºC for further analysis. Oviductal flushings from 3 animals were pooled for each replicate.
Extracted molecule total RNA
Extraction protocol RNA was isolated from a total of 20 EVs samples (4-5 replicates, 4 stages) using miRNeasy Mini kit (QIAGEN) according to the manufacturer's instructions. RNA quality and concentration were evaluated by Agilent 2100 Bioanalyzer Nano and small RNA assay (Agilent Technologies, Santa Clara, CA.) and NanoDrop (ThermoFisher).
A total of 444 ng RNA was used for the preparation of each small RNA library using NEXTflex™ Small RNA-Seq Kit v3 (Bioo Scientific). Library preparation followed the manufacturer's instructions.
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Description S2_R2
Total RNA enriched for shorter molecules.
miRNA_isoforms_counts.txt
miRNA_isoforms_summarized_counts.txt
Filtered_sequence_counttable_smallRNA_exo.txt
Filtered_sequence_counttable_smallRNA_exo_annotation_outliers_removed.txt
Data processing Clip adapter (Version 1.0.1 FASTX-toolkit by Assaf Gordon), removal of adapter sequences (3' adapter sequence (TGGAATTCTCGGGTGCCAAGG)).
PCR duplicates were removed using the four random nucleotides on each side of the RNA fragment introduced with the adapters as molecular codes by running the tool “Collapse”. Then, the four random bases were removed from each side and “Collapse” was again used to obtain the unique sequences and the corresponding read counts corrected for PCR duplicates. Subsequently, a count table for all obtained unique sequences corresponding to a small ncRNA was generated using a series of further standard Galaxy tools as well as converting tools from the ToolShed (https://toolshed.g2.bx.psu.edu/). The resulting table contained the unique sequences and the number of reads per sample.
CPM per sample filtering tool (Chen et al. 2014), removal of sequences with negligible read counts, comprising sequencing errors or sequences with very low evidence for potential expression, CPM cut-off: 8.41 cpm (corresponding to an average of 20 reads per library) for at least 3 out of 20 libraries.
Small RNA sequences were annotated based on BLAST (Basic Local Alignment Search Tool) searches against a number of sequence databases. The collection of BLAST databases contained sequences from miRBase (bovine, human, and porcine precursor and canonical mature miRNAs, release 21), transcript sequences from NCBI and Ensembl, including non-coding RNAs, as well as tRNA and piRNA cluster sequences retrieved from the NCBI Bos taurus UMD 3.1.1 GFF3 file and http://www.smallrnagroup.uni-mainz.de/piRNAclusterDB.html , Rosenkranz D. piRNA cluster database: a web resource for piRNA producing loci. Nucleic Acids Research 2016 44(D1):D223-D230, respectively.
Genome_build: bosTau8, UMD_3.1.1
Supplementary_files_format_and_content: *.txt: Tab-delimited text files:
Supplementary_files_format_and_content: Filtered_sequence_counttable_smallRNA_exo.txt: Unique sequences and read counts per sample after filtering low abundance sequences.
Supplementary_files_format_and_content: Filtered_sequence_counttable_smallRNA_exo_annotation_outliers_removed.txt: Unique sequences with annotation and read counts per sample, excluding some outlier samples.
Supplementary_files_format_and_content: miRNA_isoforms_counts.txt: isomiR sequences and read counts per sample.
Supplementary_files_format_and_content: miRNA_isoforms_summarized_counts.txt: isomiRs summarized read counts.
 
Submission date Feb 09, 2018
Last update date Jul 31, 2018
Contact name Stefan Michael Bauersachs
E-mail(s) stefan.bauersachs@uzh.ch
Organization name University of Zurich
Department Department for Farm Animals
Lab Genetics and Functional Genomics
Street address Eschikon 27 EHB 23.1
City Lindau
State/province Zurich
ZIP/Postal code 8315
Country Switzerland
 
Platform ID GPL19172
Series (2)
GSE110443 Analysis of the small non-coding RNA content of bovine oviductal extracellular vesicles during the estrous cycle
GSE110444 Analysis of the mRNA and small non-coding RNA content of bovine oviductal extracellular vesicles during the estrous cycle
Relations
BioSample SAMN08514571
SRA SRX3679050

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap
External link. Please review our privacy policy.