|
| Status |
Public on Feb 13, 2018 |
| Title |
INOF_FRT |
| Sample type |
SRA |
| |
|
| Source name |
INOF cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Immortalized normal ovarian fibroblast
treatment: none
|
| Growth protocol |
grown in OSE medium, supplemented with 10 % Hyclone fetal bovine serum and L-glutamine. Cell propagation and passaging occured once per week or as needed. Cells were trypsinized and collected in 5X10^6 pellets resuspended in 700ul TRIzol (Ambion) and kept at -80°C until RNA extraction
|
| Extracted molecule |
total RNA |
| Extraction protocol |
cDNA library produced with TGIRT
RNA was isolated and DNase treated using RNEasy mini kit (Qiagen 74106) according to the manufacturer protocol. 5ug DNA-free total RNA was then ribodepleted using Ribo-zero Gold (Illumina RZG1224 ) according to the manufacturer protocol and purified using a modified ZYMO RNA Clean and Concentrator (R1016) protocol where 8 volumes EtOH instead of 4. rRNA depleted RNA was fragmented with NEBNext Magnesium RNA Fragmentation Module (E6150) followed by dephosphorylation using T4PNK (mandel ) and purified by same modified ZYMO protocol.
cDNAs were synthesized via TGIRT template-switching with 1µM TGIRT-III reverse transcriptase (Ingex, LLC) for 15 min at 60o C, during which a DNA oligonucleotide containing the complement of an Illumina Read 2 sequencing primer-binding site becomes seamlessly linked to the 5’ cDNA end. After reaction cleanup (Qiagen MinElute Reaction cleanup 28206), a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site is then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs M0319). Properly ligated cDNAs were amplified by PCR (12 cycles) to synthesize the second strand and add Illumina flowcell capture and index sequences. Library was size-selected with Ampure XP beads (Beckman-Coulter) and quantified with Qubit and evaluated on an Agilent 2100 Bioanalyzer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Total RNA ribodepleted, fragmented (200nt)
|
| Data processing |
Reads were treated with Cutadapt (using parameters -g GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG --minimum-length 2) and Trimmomatic (with TRAILING:30)
The resulting reads were aligned to the build hg38 using STAR (--outSAMprimaryFlag AllBestScore, --alignIntronMax 1250000), unmapped reads being re-aligned with Bowtie2 (-q -I 13).
CoCo (http://gitlabscottgroup.med.usherbrooke.ca/scott-group/coco) was used to produce read counts per genes and associated CPM and TPM values from the Ensembl (v87) annotation modified with CoCo.
Genome_build: hg38
Supplementary_files_format_and_content: comma-separated-value (csv) file holding the name of every gene and their abundance value (raw counts, CPM or TPM) for each dataset
|
| |
|
| Submission date |
Feb 13, 2018 |
| Last update date |
Mar 02, 2018 |
| Contact name |
Michelle S Scott |
| E-mail(s) |
michelle.scott@usherbrooke.ca
|
| Organization name |
University of Sherbrooke
|
| Department |
Biochemistry
|
| Street address |
3201 Jean Mignault
|
| City |
Sherbrooke |
| State/province |
Quebec |
| ZIP/Postal code |
J1E 4K8 |
| Country |
Canada |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE99065 |
Simultaneous detection and relative quantification of coding and non-coding RNA using a single sequencing reaction |
|
| Relations |
| BioSample |
SAMN08527116 |
| SRA |
SRX3691797 |
