|
Status |
Public on Nov 27, 2018 |
Title |
Aff-Ligament-4 |
Sample type |
SRA |
|
|
Source name |
teres ligament
|
Organism |
Canis lupus familiaris |
Characteristics |
tissue: teres ligament sample group: affected age: adult dog id: E88
|
Growth protocol |
primary canine hip tissue, different ages and disease states at collection
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of a second ethanol wash of the RNA pellet to remove residual salt. Ribosomal RNA was subtracted from 1.5-2.5ug total RNA with the Ribozero Gold HMR kit (Illumina). Diretional RNA-seq libraries were prepared from 100 ng rRNA-subtracted RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
allSamples_genes.read_group_tracking:Lig_11 Ligament_genes.read_group_tracking:Aff_3 Ligament_gene_exp.diff:Aff_3
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. bowtie2 v2.2 was used to subtract reads mapping to canine rRNA genes and other small noncoding, non-polyA+ RNAs such as microRNAs, snoRNAs, snRNAs, etc (default mapping params, --un-gz to write non-rRNA reads to a new fastq file). tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map non-rRNA reads to the canine CanFam3 reference genome+transcriptome (Ensembl). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the canine CanFam3 transcriptome (Ensembl). cuffdiff v2.2.1 was used to call differentially expressed genes based on the canine CanFam3 transcriptome (Ensembl). Genome_build: CanFam3 Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' files contain average FPKM values for sample groups (per condition) as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' files contain raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Apr 09, 2018 |
Last update date |
Nov 27, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL20988 |
Series (1) |
GSE112874 |
Gene Expression in Hip Soft Tissues in a Natural Canine Model of Developmental Dysplasia of the Hip |
|
Relations |
BioSample |
SAMN08898013 |