|
Status |
Public on Jan 26, 2020 |
Title |
siMESH1-7002, biological rep 1 |
Sample type |
SRA |
|
|
Source name |
Human RCC4 cells with siMESH1-7002
|
Organism |
Homo sapiens |
Characteristics |
cell line: RCC4 cell type: human clear cell renal caricnoma cell line transfected with: siMESH1-7002
|
Treatment protocol |
Human clear cell renal carcinoma cell line RCC4 were transfected with siRNA targeting MESH1: (target sequence CTGAAGGTCTCCTGCTAACTA, SI04167002, Qiagen), or non-targeting siRNA control (AllStars Negative Control siRNA, SI03650318). Briefly, 10^5 RCC4 cells were seeded in a well on 6-well plate with 40 pmole of siRNA and 3μL of Lipofectamine RNAiMAX (ThermoFisher Scientific, #133778150) reagent. Cells were incubated for 72 hours before collection.
|
Growth protocol |
RCC4 cells were grow in DMEM media with 4.5g/L glucose and 4mM glutamine (11995-DMEM, ThermoFisher Scientific) and supplement with 10% heat-inactivated fetal bovine serum (Hyclone #SH30070.03HI) in humidified incubator, 37°C with 5% CO2
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted using RNeasy Mini Kit (Qiagen, #74104) according to the manufacturer's instructions. 1μg of total RNA was used to generate cDNA library with Illumina TruSeq Stranded mRNA LT Sample Prep Kit – Set A (Illumina, RS-122-2101) according to manufacturer’s instructions.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 4000 |
|
|
Description |
RCC4-siMESH1-7002-1_S13_L002_R1_001
|
Data processing |
FastQC was used for confirming quality of sequencing reads. Sequenced reads were mapped to hg19 reference genome using Hisat2 with default parameters Quntification of read counts of genes were performed using HTSeq DESeq2 were applied for differential analysis to compare gene expressions between conditions. Genome_build: hg19 Supplementary_files_format_and_content: tab-delimited text files include results of differential analysis using DESeq2.
|
|
|
Submission date |
May 14, 2018 |
Last update date |
Jan 26, 2020 |
Contact name |
Jen-Tsan Ashley Chi |
E-mail(s) |
jentsan.chi@duke.edu
|
Phone |
9196684759
|
Organization name |
Duke University
|
Lab |
Jen-Tsan Ashley Chi
|
Street address |
101 Science Drive, DUMC 3382
|
City |
Durham |
State/province |
NC |
ZIP/Postal code |
27708 |
Country |
USA |
|
|
Platform ID |
GPL20301 |
Series (1) |
GSE114282 |
Transcriptional profile of MESH1-silenced RCC4 cells |
|
Relations |
BioSample |
SAMN09206544 |
SRA |
SRX4081158 |