 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 26, 2021 |
| Title |
RNA-seq_GFP knockdown control day1 #1 |
| Sample type |
SRA |
| |
|
| Source name |
C2C12
|
| Organism |
Mus musculus |
| Characteristics |
cell line: C2C12
days after inducing differentiation: 1
knockdown target: GFP (control)
|
| Treatment protocol |
For consitutive APOBEC2 knockdown C2C12s were infected with lentiviruses carrying shRNAs, targeting APOBEC2 (or GFP as a control). Lentiviruses were produced by co-transfection of pLKO.1-puro short hairpins containing construct, packaging plasmid psPAX2 (Addgene, #12260) and envelope plasmid pMD2.g (Addgene, #12259) in HEK 293T cells. Transfections were done using Lipofectamine 2000 Reagent (Lifetechnologies) as per manufacturer instructions. Supernatants with lentiviral particles were collected at 24 and 48 hours after transfection, passed through a 0.45 mm filter and applied to C2C12s. For APOBEC2 constitutive knockdown 30% confluent cells were infected with pLKO.1 containing lentivirus in growth media containing 8ug/mL polybrene for 12 hours. Two days after lentiviral infection cells were cultured with 4ug/ml virus-free puromycin containing media for two more days to select cells stably expressing the shRNAs. All APOBEC2 shRNAs were obtained from The Broad Institute’s Mission TRC-1 mouse library and are present in pLKO.1-puro construct, which carries the puromycin-resistance gene and drives shRNA transcription from a human U6 promoter. Plasmids used: pLKO.1 - TRC cloning vector (Addgene, # 10878) (Moffat et al., 2006); pLKO.1 puro GFP siRNA (Addgene, # 12273) (Orimo et al., 2005). The design of shRNAs and cloning in pLKO.1-TRC, were done according to the Addgene protocol. The following siRNAs sequences were used: for Apobec2 knockdown GCTACCAGTCAACTTCTTCAA; for GFP knockdown control GCAAGCTGACCCTGAAGTTCAT
|
| Growth protocol |
C2C12 cells (CRL-1772, ATCC) were maintained in DMEM (30-2002, ATCC) with 10% fetal bovine serum (FBS) and feed every two days. To differentiate equal number of cells (0.25 x 10^6) were seeded in 6-well plates followed by media change to DMEM with 2% horse serum after 12 hours. For generating single cell clones for RNA- seq experiment C2C12s were sorted using fluorescence-activated cell sorting (FACS) and seeded into a 96 well plate. Each clone was expanded and tested for successful knockdown through immunoblotting. RNA was extracted at these timepoints following differentiation: Day0 (no differentiation), Day1 (one day after inducing differentiation, Day2 (two days after inducing differentiation).
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA was extracted using TRIzol LS Reagent (ambion, 10296-010) per manufacter's instruction
Library preparation and sequencing were done using TruSeq Stranded mRNA Sample Prep kit as per manufacturer’s instruction. The procedure includes purification of poly-adenylated RNAs.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Group_A2_d1_minus_G_d1DEG.txt
|
| Data processing |
Paired-end reads were aligned to mm10 genome using the subjunc function in the Bioconductor Rsubread (Liao et al., 2013) package.
Reads to genomic features (gene) were counted using the featureCounts function in the Bioconductor Rsubread (Liao et al., 2013) package
bigWig files for visualization were generated from aligned reads using the Bioconductor rtracklayer (Lawrence et al., 2009) and GenomicAlignments packages (Lawrence et al., 2013).
Transcript quantifications were performed using Salmon (Patro et al., 2017) in quasi-mapping mode. Gene expression values were calculated from transcript quantifications using tximport (Soneson et al., 2016).
Gene expression changes were identified using the Wald test implemented in DESeq2 (Love et al., 2014).
Annotation files used: BSgenome.Mmusculus.UCSC.mm10 (v1.4.0); org.Mm.db(v3.5.0); TxDb.Mmusculus.UCSC.mm10.knownGene.gtf.gz (v3.4.0)
Genome_build: mm10
Supplementary_files_format_and_content: DESeq2 results are the output from the results function of DESeq2 (Love et al., 2014). It contains log2 fold change, the effect size estimate, or the gene expression changes between two groups (comparison are indicated in the file name eg G_d0 = control sample at day0 and A2_d0 is Apobec2 knockdown sample at day0). Here gene ID and name included is based on annotation using TxDb.Mmusculus.UCSC.mm10.knownGene.gtf.gz (v3.4.0) and org.Mm.db(v3.5.0).
Transcript per million (TMP) results contains TPM results for each of the biological replicates for each group (on series record).
bigWig file contains normalised RNA-seq signal across the genome. Useful for display of the normalized RNA-Seq signal at their location in the genome in a track format for uploading into a genome browser such as the UCSC genome browser or Broad Institute's IGV.
Gene read counts is the output of the featureCounts of Rsubread (Liao et al., 2013) package, showing the number of reads to each genomic feature (gene)
|
| |
|
| Submission date |
Jul 26, 2018 |
| Last update date |
Jul 26, 2021 |
| Contact name |
Nina Papavasiliou |
| E-mail(s) |
n.papavasiliou@dkfz-heidelberg.de
|
| Organization name |
German Cancer Research Center (DKFZ)
|
| Department |
Division of Immune Diversity (D150) Deutsches Krebsforschungszentrum
|
| Lab |
Prof. Dr. Nina Papavasiliou
|
| Street address |
Im Neuenheimer Feld 280
|
| City |
Heidelberg |
| ZIP/Postal code |
69120 |
| Country |
Germany |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE117730 |
A novel role for the conserved, orphan deaminase APOBEC2 [RNA-seq] |
| GSE117732 |
A novel role for the conserved, orphan deaminase APOBEC2 |
|
| Relations |
| BioSample |
SAMN09724684 |
| SRA |
SRX4473646 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3307832_Sorted_G_d1_1FullNormalisedRPM.bw |
98.1 Mb |
(ftp)(http) |
BW |
| GSM3307832_Sorted_G_d1_1_subread_Gene.Counts.txt.gz |
101.5 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
