|
Status |
Public on Dec 21, 2018 |
Title |
Mcm4^C3/C3 dam female1 |
Sample type |
SRA |
|
|
Source name |
Placenta
|
Organism |
Mus musculus |
Characteristics |
strain: C3Heb/FeJ tissue: Placenta age: E13.5 placental genotype: Mcm4^C3/C3 Mcm2^Gt/+ maternal genotype: Mcm4^C3/C3 dam placental sex: female
|
Treatment protocol |
N/A
|
Growth protocol |
mice were raised in standard lab housing
|
Extracted molecule |
total RNA |
Extraction protocol |
Placentas from E13.5 embryos were isolated and total RNA extracted using an Ezna total RNA extraction kit (Omega) Diretional RNA-seq libraries were prepared from 1 µg total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
compareFemales_gene_exp.diff: C3DamF_0 compareFemales_genes.read_group_tracking: C3DamF_0
|
Data processing |
Illumina pipeline software v1.8 was used for base calling. cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads. tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC). cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC). cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC). Genome_build: mouse mm10 reference (UCSC) Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The '*gene_exp.diff' files contain average FPKM values for each set of replicates as well as results for statistical testing for differential expression. The '*genes.read_group_tracking' files contain raw mapped read counts and FPKM values for individual samples.
|
|
|
Submission date |
Sep 10, 2018 |
Last update date |
Dec 21, 2018 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (1) |
GSE119710 |
Female-biased embryonic death from genomic instability-induced inflammation |
|
Relations |
BioSample |
SAMN10024992 |
SRA |
SRX4664249 |