|
| Status |
Public on Dec 21, 2018 |
| Title |
Mcm4^C3/+ Mcm2^Gt/+ dam female1 |
| Sample type |
SRA |
| |
|
| Source name |
Placenta
|
| Organism |
Mus musculus |
| Characteristics |
strain: C3Heb/FeJ
tissue: Placenta
age: E13.5
placental genotype: Mcm4^C3/C3 Mcm2^Gt/+
maternal genotype: Mcm4^C3/+ Mcm2^Gt/+ dam
placental sex: female
|
| Treatment protocol |
N/A
|
| Growth protocol |
mice were raised in standard lab housing
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Placentas from E13.5 embryos were isolated and total RNA extracted using an Ezna total RNA extraction kit (Omega)
Diretional RNA-seq libraries were prepared from 1 µg total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
compareFemales_gene_exp.diff: C3M2DamF_0
compareFemales_genes.read_group_tracking: C3M2DamF_0
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: mouse mm10 reference (UCSC)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The '*gene_exp.diff' files contain average FPKM values for each set of replicates as well as results for statistical testing for differential expression. The '*genes.read_group_tracking' files contain raw mapped read counts and FPKM values for individual samples.
|
| |
|
| Submission date |
Sep 10, 2018 |
| Last update date |
Dec 21, 2018 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE119710 |
Female-biased embryonic death from genomic instability-induced inflammation |
|
| Relations |
| BioSample |
SAMN10025014 |
| SRA |
SRX4664252 |
