 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 03, 2019 |
| Title |
20_WT_M_STR |
| Sample type |
SRA |
| |
|
| Source name |
WT_M_STR
|
| Organism |
Mus musculus |
| Characteristics |
strain background: 129S1
genotype/variation: WT
Sex: M
tissue region: Striatum of the mouse brain [STR]
nucleic acid (ng/ul): 305.1
a260 (abs): 7.628
a280 (abs): 3.65
260/280: 2.09
260/230: 2.12
|
| Treatment protocol |
A 4.9 kb-long DNA fragment (chr7: 149,796,331-149,801,250 in mm9) was deleted from the intergenic region of H19 and Igf2 by classical ES cell gene targeting and blastocyst injection in the mouse on the 129S1 genetic background. One loxP site remained at the site of the deletion mutation after the excision of the Pgkneo positive selection cassette by crossing the targeted mutant male mouse to an Hprt-CRE transgenic female39. Three oligonucleotide primers, IGKOCrerecU: CGGAATGTTTGTGTGGAGAGCA; IGKOwtU: TAGGGGTCCTGAAGACGTCAG; and IGKOCreWTL: TTGGTGTAGCACCCTGTAACCC are combined in one PCR reaction to distinguish the mutant from the wild type allele, as visualized by a 450 bp or a 350 bp long PCR product, respectively.
|
| Growth protocol |
Mice were bred and housed in ventilated polycarbonate cages, and given ad libitum sterile food (LabDiet 5021) and water. Adult mice were housed by sex in groups of 2-5 littermates. The vivarium was maintained under controlled temperature (21°C±1°C) and humidity (50-60%), with a 12-h diurnal cycle (lights on: 0700-1900). Approximately equal numbers of male and female were tested, and no sex differences were detected (in all Western blotting, HPLC, and transcriptomic experiments). No animals were excluded from the study. Wild-type (+/+) and homozygous knock-out (Igf2 enh-/-) adult mice (~2.5 months old) were tested, and sample sizes were comparable to other studies of Igf2 mutant mice40, 41. All animal procedures were approved by the Institutional Animal Care Committee of the Van Andel Research Institute and complied with the requirements of the Institutional Animal Care and Use Committee (AUP # PIL-17-10-010).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Brain tissue (~25 mg) was homogenized with a ceramic bead-based homogenizer (Precellys, Bertin Instruments) in 1 mL of Trizol (Life Technologies). Total RNA was isolated according to the Trizol manufacturer’s instructions, treated with RNase-free DNase I (Qiagen) at room temperature for 30 min, and cleaned up with the RNeasy Mini Kit (Qiagen). RNA yield was quantified using a NanoDrop ND-1000 (Thermo Fisher Scientific), and RNA integrity was verified via the Agilent Bioanalyzer 2100 system (Agilent Technologies).
Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA, using the KAPA RNA HyperPrep Kit with RiboseErase (v1.16) (Kapa Biosystems). RNA was sheared to 300-400 bp. Prior to PCR amplification, cDNA fragments were ligated to Bio Scientific NEXTflex Adapters (Bioo Scientific). Quality and quantity of the finished libraries were assessed using a combination of Agilent DNA High Sensitivity chip (Agilent Technologies, Inc.), QuantiFluor® dsDNA System (Promega Corp.), and Kapa Illumina Library Quantification qPCR assays (Kapa Biosystems). Individually indexed libraries were pooled, and 75 bp single-end sequencing was performed on an Illumina NextSeq 500 sequencer, with all libraries run across 3 flow cells. Base calling was done by Illumina NextSeq Control Software (NCS) v2.0 and output of NCS was demultiplexed and converted to FastQ format with Illumina Bcl2fastq v1.9.0.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Base calling was done by Illumina NextSeq Control Software (NCS) v2.0 and output of NCS was demultiplexed and converted to FastQ format with Illumina Bcl2fastq v1.9.0.
Single-end 75 bp reads were generated for the RNA-seq experiment. Trimgalore v0.5.0 (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) was used to trim low-quality bases. STAR (Dobin et al. (2013).Bioinformatics. 29:15-21; PMC3530905) was used to align the reads to the genome. The genome index was generated using STAR using GRCm38.primary_assembly.genome.fa as the reference sequence and gencode.vM15.primary_assembly.annotation.gtf as the gene definition file. The genome fasta sequence was downloaded from ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz and gene definitions from ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/gencode.vM15.primary_assembly.annotation.gtf.gz.
Genome_build: GRCm38
Supplementary_files_format_and_content: SCZ_RNAseq_STAR_counts.csv - raw gene-level transcript counts per sample. CSV format
|
| |
|
| Submission date |
Sep 25, 2018 |
| Last update date |
May 03, 2019 |
| Contact name |
Shraddha Pai |
| E-mail(s) |
shraddha.pai@utoronto.ca
|
| Organization name |
University of Toronto
|
| Street address |
160 College Street, Room 602
|
| City |
Toronto |
| State/province |
ON |
| ZIP/Postal code |
M5S 3E1 |
| Country |
Canada |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE112525 |
DNA methylation in neurons from post-mortem brains in schizophrenia and bipolar disorder |
| GSE120423 |
Brain transcriptome profiling in wildtype mice and mice with Igf2 enhancer deletion (Igf2enh-/-) [RNA-seq] |
|
| Relations |
| BioSample |
SAMN10127264 |
| SRA |
SRX4736760 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
