Starting oligonucleotide pool (before nucleosome reconstitution)
Extracted molecule
other
Extraction protocol
170-mer oligonucleotides containing a 150 base variable sequence and a 20 bp common sequence (5’- TCTCCCTATAGTGAGTCGTA-3’) were synthesized by Agilent. 10ng (0.2pmol) of the single stranded oligo pools was double stranded via primer extension. Briefly, 2pmol of the reverse complement of the common sequence (5’-CTAATACGACTCACTATAGGG-3’) was first annealed to the oligos. Sequences were double stranded using 1mM dNTP, 3U T4 DNA polymerase (NEB), 5U Klenow fragment (NEB), 1X NEB2 buffer, 1X BSA, and incubated at 30°C for 30 minutes. The reaction product was phenol:chloroform extracted, precipitated with ammonium acetate and ethanol, washed with 70% ethanol, dried, and resuspended in dH¬2O. 10pmol of an M13 primer duplex (5’-CAGGAAACAGCTATGAGC-3’/5’-P-GCTCATAGCTGTTTCCTG-3’) was then ligated to the double stranded oligos using 400U T4 DNA ligase (NEB) overnight at 16°C. Ligation products were end-labeled with T4 polynucleotide kinase and [γ-32P] ATP and the expected 188bp product was isolated from a 4% polyacrylamide gel. To remove potential concatamers, ligation products were PCR amplified using extended primers containing the SwaI restriction site: Forward primer, 5’-GCATGATCGACTGCGAATTTGATTTAAATCTAATACGACTCACTATAGGG -3’; Reverse primer, 5’-ATGACACATTATGACCAAAGATCGATTTAAATCAGGAAACAGCTATGAGC-3’. PCR products were digested with SwaI (NEB). The resultant 197bp product was gel purified from a 2.8% agarose gel and assembled into nucleosomes via salt gradient dialysis, using 6 µg histone octamer + 12 µg DNA in a 200 µl volume. The resulting nucleosomes were separated away from the remaining naked DNA by native polyacrylamide gel electrophoresis (5% (w/v) polyacrylamide) in 1/3x TBE buffer (TBE is 90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.3). The nucleosome-containing band was excised from the gel, and its DNA extracted by crushing and soaking into 0.3 M NaOAc, 0.5 M NH4OAc, 0.1 mM EDTA, 0.1% (w/v) SDS, followed by ethanol precipitation.
Label
Cy3
Label protocol
1ng of each of the input and nucleosome-reconstituted pools were labeled via PCR using Cy3 and Cy5 labelled primers.
Equal amounts of labeled input (Cy3 labeled) and reconstituted (Cy5 labeled) products along with 5µM of blocking primer were hybridized to tracking arrays in SSPE buffer containing 42% formamide and 0.01% SDS at 42°C for 20 hours. Arrays were washed first with 6X SSPE and 0.005% sarcosine, followed by 0.6X SSPE.
Scan protocol
Arrays were scanned using Agilent Technologies microarray scanner G2565.
Description
Hybridization of nucleosome-reconstituted pool #3 (DT+ES pools combined)
Data processing
Arrays were quantified and normalized (spatial detrending and Loess) using Agilent Feature Extraction 9.5 Software. Normalized data from both input (Cy3) and reconstituted (Cy5) channels are reported as log2(reconstituted/input) ratios.
