|
| Status |
Public on Nov 15, 2021 |
| Title |
mrna_72_cas9_rna_b |
| Sample type |
SRA |
| |
|
| Source name |
HEK293 cell line
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: HEK293 cell line
treatment: Cas9 RNP nucleofection
timepoint: 72 hours
|
| Treatment protocol |
Cas9, dCas9, and D10A Cas9 ribonucleoproteins (RNPs) targeting intron 12 of JAK2 were prepared as detailed in (Lingeman et al., 2017). 300 pmol Cas9 and 300 pmol guideRNA were added to 1 x 106 cells suspended in 100 μl SF Solution (Lonza). HEK cells were nucleofected using program CM-130 in the X Unit of a Lonza 4D-Nucleofector (AAF-1002X, AAF-1002B) and pre-warmed media was immediately added to the cuvettes to increase cell viability.
|
| Growth protocol |
HEK 293 (ATCC) cell lines were cultured in DMEM, high glucose, GlutaMAX (Gibco) with 10% FBS (VWR) in a 37°C incubator with 5.0% CO2 and 20% O2. HEK cells were passaged 2 days before nucleofection and trypsinized at 60-90% confluency.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Denaturing RNA extraction, rRNA depletion, stranded RNA-Seq library generation
Total RNA was prepared by detergent lysis.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Adapter trimming with fastx_clipper v0.0.14 -Q33 -a AGATCGGAAGAGCACACGTCTGAA -n -v
Alignment with hisat2 v2.1.0 using GRCh38
Footprint counting using custom fp-count script and Gencode v22 APPRIS principal splice isoforms
Genome_build: GRCh38
Supplementary_files_format_and_content: qexpr.txt files are tab-delimited text files with three columns: transcript id, CDS length, and read count
|
| |
|
| Submission date |
Nov 16, 2018 |
| Last update date |
Nov 15, 2021 |
| Contact name |
Nicholas T Ingolia |
| E-mail(s) |
ingolia@berkeley.edu, nick@ingolia.org
|
| Phone |
510 664 7071
|
| Organization name |
University of California, Berkeley
|
| Department |
Molecular and Cell Biology
|
| Lab |
Ingolia
|
| Street address |
1 Barker Hall # 3202
|
| City |
Berkeley |
| State/province |
CA |
| ZIP/Postal code |
94720 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE122615 |
Double Stranded DNA Breaks and Genome Editing Trigger Ribosome Remodeling and Translational Shutdown |
|
| Relations |
| BioSample |
SAMN10434979 |
| SRA |
SRX5016641 |
