NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3476293 Query DataSets for GSM3476293
Status Public on Nov 15, 2021
Title mrna_72_dcas9_rna_b
Sample type SRA
 
Source name HEK293 cell line
Organism Homo sapiens
Characteristics tissue: HEK293 cell line
treatment: dCas9 RNP nucleofection
timepoint: 72 hours
Treatment protocol Cas9, dCas9, and D10A Cas9 ribonucleoproteins (RNPs) targeting intron 12 of JAK2 were prepared as detailed in (Lingeman et al., 2017). 300 pmol Cas9 and 300 pmol guideRNA were added to 1 x 106 cells suspended in 100 μl SF Solution (Lonza). HEK cells were nucleofected using program CM-130 in the X Unit of a Lonza 4D-Nucleofector (AAF-1002X, AAF-1002B) and pre-warmed media was immediately added to the cuvettes to increase cell viability.
Growth protocol HEK 293 (ATCC) cell lines were cultured in DMEM, high glucose, GlutaMAX (Gibco) with 10% FBS (VWR) in a 37°C incubator with 5.0% CO2 and 20% O2. HEK cells were passaged 2 days before nucleofection and trypsinized at 60-90% confluency.
Extracted molecule total RNA
Extraction protocol Denaturing RNA extraction, rRNA depletion, stranded RNA-Seq library generation
Total RNA was prepared by detergent lysis.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 4000
 
Data processing Adapter trimming with fastx_clipper v0.0.14 -Q33 -a AGATCGGAAGAGCACACGTCTGAA -n -v
Alignment with hisat2 v2.1.0 using GRCh38
Footprint counting using custom fp-count script and Gencode v22 APPRIS principal splice isoforms
Genome_build: GRCh38
Supplementary_files_format_and_content: qexpr.txt files are tab-delimited text files with three columns: transcript id, CDS length, and read count
 
Submission date Nov 16, 2018
Last update date Nov 15, 2021
Contact name Nicholas T Ingolia
E-mail(s) ingolia@berkeley.edu, nick@ingolia.org
Phone 510 664 7071
Organization name University of California, Berkeley
Department Molecular and Cell Biology
Lab Ingolia
Street address 1 Barker Hall # 3202
City Berkeley
State/province CA
ZIP/Postal code 94720
Country USA
 
Platform ID GPL20301
Series (1)
GSE122615 Double Stranded DNA Breaks and Genome Editing Trigger Ribosome Remodeling and Translational Shutdown
Relations
BioSample SAMN10434893
SRA SRX5016643

Supplementary file Size Download File type/resource
GSM3476293_mrna_72_dcas9_rna_b_qexpr.txt.gz 677.3 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap