 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 16, 2020 |
| Title |
CSB_2: CSB WT rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Cockayne Syndrome Patient Derived Fibroblasts
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: CS1AN Cockayne Syndrome Patient Derived Human Fibroblasts
genotype/variation: pCSB-GFP expressing stable cell lines
|
| Growth protocol |
Cells were cultured in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in a humidified chamber under 5% CO2 at 37 °C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cell are harvested with Buffer RLT. RNA was harvested using Rneasy mini kit extraction Kit (Invitrogen cat no: 74104)
Briefly, mRNA from Eukaryote organisms is purified from total RNA using poly-T oligo-attached magnetic beads (For prokaryotes, mRNA was purified through the removal of rRNA by using kit). The mRNA is first fragmented randomly by addition of fragmentation buffer. According to demand of customer, we have NEB library and strand specific library to choose.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
Patient-derived cell lines with mutations in CSB (CS1AN) stable expressing full lenght CSB. CSB play roles in DNA repair and other aspects of DNA metabolism.
|
| Data processing |
Raw image data file from high-throughput sequencing(like Illumina ) was transformed to Sequenced Reads (called Raw Data or Raw Reads) by CASAVA base recognition (Base Calling). Raw Data is stored in FASTQ(fq) format files, which contain reads sequence and corresponding base quality.FASTQ format described by four lines:@HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGTNAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT+#55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHHLine 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line).Line 2 is the raw sequence letters.Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.The details of Sequencing identifier of Illumina are as follows:(1) HWI-ST1276:71 HWI-ST1276,Instrument – unique identifier of the sequencer; 71,run number – Run number on instrument(2) C1162ACXX:1:1101:1208:2458 means the coordinate of read on C1162ACXX(Flowcell ID)flowcell,line 1, 1101 tile is(x=1208,y=2458)(3) 1:N:0:CGATGT the first number is 1 or 2, 1 means single reads or the first read of paired ends, 2 means the second of paired ends; the second letter means whether reads is adjusted(Y means yes, N means no); the third number represent the number of Control Bits in sequence; six bases on the fourth place is Illumina index sequence.
For RNA-seq technology, sequencing error rate distribution has two features. Error rate grows with sequenced reads extension for the consumption of sequencing reagent. The phenomenon is common in the Illumina high-throughput sequencing platform (Erlich Y, Mitra PP et al.2008; Jiang L, Schlesinger F et al.2011.). The first six bases have a relatively high error rate. The reason is incomplete binding of the random hex-primers and RNA template in cDNA synthesis (Jiang et al.). In general, a single base error rate should be lower than 1%.
GC-content is used to detect potential AT/GC separation.
The Sequenced Reads/raw reads often contain low quality reads or reads with adaptors. In order to avoid this, it's necessary to filter the raw reads under conditions to get the clean reads. Raw reads filtering conditions are as follows:(1) Remove reads containing adaptors;(2) Remove reads containing N > 10% (N represents base that could not be determined);(3) The Qscore (Quality value) of over 50% bases of the read is <= 5.RNA-seq Adapter information:NEBNext® UltraTM RNA Library Prep KitRNA 5' Adapter(5'Adaptor)5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTRNA 3' Adapter(3'Adaptor,The underlined 6bp bases is Index)5' GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Genome_build: hg19
Supplementary_files_format_and_content: MS Excel format containing raw counts
|
| |
|
| Submission date |
Nov 20, 2018 |
| Last update date |
Jun 22, 2020 |
| Contact name |
Supriyo De |
| Organization name |
NIA-IRP, NIH
|
| Department |
Laboratory of Genetics and Genomics
|
| Lab |
Computational Biology & Genomics Core
|
| Street address |
251 Bayview Blvd
|
| City |
Baltimore |
| State/province |
Maryland |
| ZIP/Postal code |
21224 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE122736 |
Convergence of Cockayne Syndrome Group A and B Proteins at rRNA Transcription through Nucleolin Regulation |
|
| Relations |
| BioSample |
SAMN10449983 |
| SRA |
SRX5028423 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3484363_CSB_2.xlsx |
846.6 Kb |
(ftp)(http) |
XLSX |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
