Batch cultures of Synechococcus sp. strains WH8102 were grown in chelexed SOW media, as previously described by Dupont et al. (1) with the exception that copper was not added to the media in the trace metal mix and nickel was added at final concentration of 0.5 nM. The cultures were grown at 24C under constant light at approximately 80 M photons m-2 s-1 in trace metal clean polycarbonate or glass and until in mid-exponential phase, as measured by fluorescence-based growth curve and validated later with flow cytometry.
Extracted molecule
total RNA
Extraction protocol
Half the batch culture was spun down at room temperature at 10,400 g, resuspended in Trizol and frozen at -80C for eventual RNA extraction, taking care that the harvesting time stayed under 30 minutes. Cu/EDTA was added to the other half for Cu2+ levels of pCu 11.1 (as determined using a MINEQL (2) calculation). After a two-hour incubation, these cells were harvested as outlined above. All samples were then thawed at room temperature, incubated for 60 minutes at 65C. Chloroform at 0.2X was then added to the Trizol cell mixture and tubes were shaken vigorously by hand for 30 seconds. The samples were then incubated at room temperature for 10 minutes, spun down at 4C at 12,0000 g for 15 minutes and the aqueous layer was carefully removed. 1X volume of cold isopropanol was then added, incubated on ice for 12 minutes, and spun down at 4C at 12,000 g for 15 minutes. The supernatant was removed and the pellet was washed with 1X volume cold 75% ethanol and stored at -20C overnight. The samples were then spun down again at 4C at 12,000 g for 15 minutes, resuspended in smaller tubes and spun down once more in the same conditions. The supernatant was then removed, and the pellet given at least 30 minutes to dry before resuspension in 100 µl DEPC-treated water. Concentrations were then assessed using a NanoDrop spectrophotometer and if greater than 100 µg were split and diluted before proceeding. The RNA was then cleaned using a Qiagen RNeasy kit with two additional RNase-free DNase treatments on column according to the manufacturer’s specifications. 1. Dupont, C. L., K. Barbeau, and B. Palenik. 2008. Ni uptake and limitation in marine Synechococcus strains. Applied and Environmental Microbiology 74:23-31. 2. Westall, J. C., J. L. Zachary, and F. M. M. Morel. 1976. MINEQL-General algorithm for computation of chemical –equilibrium in aqueous systems. Abstracts of Papers of the American Chemical Society 172:8-8.
Label
Cy3
Label protocol
Make spike-in control pools from RNA amplified from cloned Arabidopsis thaliana genes (cab, ltp4, rca, rbcL, ltp6, rcp1, nac, xcp2, prk, and tim) using the MegaScript Kit (Ambion) by combining for Cy5 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 4.7 microliters 13.279 ng/microliter ltp6 RNA; 11.8 microliters 21.313 ng/microliter rcp1 RNA; 40.7 microliters 23.23 ng/microliter nac RNA; 4.6 microliters 18.177 ng/microliter xcp2 RNA; 14.7 microliters 11.436 ng/microliter prk RNA; 18.9 microliters 11.084 ng/microliter tim RNA; 826.5 microliters water. And for Cy3 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 1.6 microliters 13.279 ng/microliter ltp6 RNA; 3.9 microliters 21.313 ng/microliter rcp1 RNA; 13.6 microliters 23.23 ng/microliter nac RNA; 13.9 microliters 18.177 ng/microliter xcp2 RNA; 44.1 microliters 11.436 ng/microliter prk RNA; 56.8 microliters 11.084 ng/microliter tim RNA; 788.1 microliters water. To label RNA sample combine: 4 micrograms RNA; 2 microliters 3 mg/mL random hexamers (Invitrogen); 2 microliters arabidopsis spike-in control RNA; DEPC water to a final volume to 17.5 microliters. Mix and incubated at 70 degrees C for 10 minutes. Snap-freeze in dry ice/ethanol for 30 seconds and centrifuged for 1 minute at approximately 16,000g. Add: 6 microliters 5X Superscript II buffer (Invitrogen); 3 microliters 0.1 M dithiothreitol; 1.2 microliters aminoallyl-dNTP mix containing 12.5 mM dATP, 12.5 mM dCTP, 12.5 mM dGTP, 4.16 mM dTTP, and 8.33 mM aadUTP; 2 microliters SuperScript II (Invitrogen). Mix and incubated overnight at 42 degrees C. Add: 10 microliters 1 M NaOH; 10 microliters 0.5 M EDTA. Incubate for 15 minutes at 65 degrees C. Add: 25 microliters 1 M Tris pH 7.4; 400 microliters PB buffer (Qiagen). Apply sample to QIAquick column (Qiagen). Centrifuge for 1 minute at 15,000g. Wash with 750 microliters phosphate wash buffer (84.25 mL 95% EtOH + 15.25 mL water + 0.5 mL 1 M KPO4 pH 8.5 solution made by combining 0.5 mL 1M KH2PO4 with 9.5 mL 1M K2HPO4). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters phosphate elution buffer (4 mM KPO4 solution made by diluting 1 M KPO4 pH 8.5 solution). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Dry sample using a speed vac. Resuspend cDNA in 4.5 microliters 0.1 M carbonate buffer (1 M Na2CO3 buffer pH 9.0 diluted 1:10 with water). Allow the sample to resuspend for 15 minutes at room temperature. Add 4.5 microliters NHS-Cy (Amersham) resuspended in 73 microliters DMSO. Incubate for 1 hour at room temperature in the dark. Add 4.5 microliters 4 M hydroxylamine. Incubate for 15 minutes at room temperature in the dark. Add: 35 microliters 100 mM NaOAc pH 5.2; 500 microliters PB buffer. Apply to Qiaquick column. Centrifuge for 1 minute at 15,000g. Wash with 750 microliters PE buffer (Qiagen). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters EB buffer (Qiagen). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Check quality of probes spectrophotometrically from 200nm to 700nm. Store at -80 degrees C.
Batch cultures of Synechococcus sp. strains WH8102 were grown in chelexed SOW media, as previously described by Dupont et al. (1) with the exception that copper was not added to the media in the trace metal mix and nickel was added at final concentration of 0.5 nM. The cultures were grown at 24C under constant light at approximately 80 M photons m-2 s-1 in trace metal clean polycarbonate or glass and until in mid-exponential phase, as measured by fluorescence-based growth curve and validated later with flow cytometry.
Extracted molecule
total RNA
Extraction protocol
Half the batch culture was spun down at room temperature at 10,400 g, resuspended in Trizol and frozen at -80C for eventual RNA extraction, taking care that the harvesting time stayed under 30 minutes. Cu/EDTA was added to the other half for Cu2+ levels of pCu 11.1 (as determined using a MINEQL (2) calculation). After a two-hour incubation, these cells were harvested as outlined above. All samples were then thawed at room temperature, incubated for 60 minutes at 65C. Chloroform at 0.2X was then added to the Trizol cell mixture and tubes were shaken vigorously by hand for 30 seconds. The samples were then incubated at room temperature for 10 minutes, spun down at 4C at 12,0000 g for 15 minutes and the aqueous layer was carefully removed. 1X volume of cold isopropanol was then added, incubated on ice for 12 minutes, and spun down at 4C at 12,000 g for 15 minutes. The supernatant was removed and the pellet was washed with 1X volume cold 75% ethanol and stored at -20C overnight. The samples were then spun down again at 4C at 12,000 g for 15 minutes, resuspended in smaller tubes and spun down once more in the same conditions. The supernatant was then removed, and the pellet given at least 30 minutes to dry before resuspension in 100 µl DEPC-treated water. Concentrations were then assessed using a NanoDrop spectrophotometer and if greater than 100 µg were split and diluted before proceeding. The RNA was then cleaned using a Qiagen RNeasy kit with two additional RNase-free DNase treatments on column according to the manufacturer’s specifications. 1. Dupont, C. L., K. Barbeau, and B. Palenik. 2008. Ni uptake and limitation in marine Synechococcus strains. Applied and Environmental Microbiology 74:23-31. 2. Westall, J. C., J. L. Zachary, and F. M. M. Morel. 1976. MINEQL-General algorithm for computation of chemical –equilibrium in aqueous systems. Abstracts of Papers of the American Chemical Society 172:8-8.
Label
Cy5
Label protocol
Make spike-in control pools from RNA amplified from cloned Arabidopsis thaliana genes (cab, ltp4, rca, rbcL, ltp6, rcp1, nac, xcp2, prk, and tim) using the MegaScript Kit (Ambion) by combining for Cy5 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 4.7 microliters 13.279 ng/microliter ltp6 RNA; 11.8 microliters 21.313 ng/microliter rcp1 RNA; 40.7 microliters 23.23 ng/microliter nac RNA; 4.6 microliters 18.177 ng/microliter xcp2 RNA; 14.7 microliters 11.436 ng/microliter prk RNA; 18.9 microliters 11.084 ng/microliter tim RNA; 826.5 microliters water. And for Cy3 pool: 5.2 microliters 20.3 ng/microliter cab RNA; 12.5 microliters 16.839 ng/microliter ltp4 RNA; 18.6 microliters 22.634 ng/microliter rca RNA; 41.8 microliters 15.068 ng/microliter rbcL RNA; 1.6 microliters 13.279 ng/microliter ltp6 RNA; 3.9 microliters 21.313 ng/microliter rcp1 RNA; 13.6 microliters 23.23 ng/microliter nac RNA; 13.9 microliters 18.177 ng/microliter xcp2 RNA; 44.1 microliters 11.436 ng/microliter prk RNA; 56.8 microliters 11.084 ng/microliter tim RNA; 788.1 microliters water. To label RNA sample combine: 4 micrograms RNA; 2 microliters 3 mg/mL random hexamers (Invitrogen); 2 microliters arabidopsis spike-in control RNA; DEPC water to a final volume to 17.5 microliters. Mix and incubated at 70 degrees C for 10 minutes. Snap-freeze in dry ice/ethanol for 30 seconds and centrifuged for 1 minute at approximately 16,000g. Add: 6 microliters 5X Superscript II buffer (Invitrogen); 3 microliters 0.1 M dithiothreitol; 1.2 microliters aminoallyl-dNTP mix containing 12.5 mM dATP, 12.5 mM dCTP, 12.5 mM dGTP, 4.16 mM dTTP, and 8.33 mM aadUTP; 2 microliters SuperScript II (Invitrogen). Mix and incubated overnight at 42 degrees C. Add: 10 microliters 1 M NaOH; 10 microliters 0.5 M EDTA. Incubate for 15 minutes at 65 degrees C. Add: 25 microliters 1 M Tris pH 7.4; 400 microliters PB buffer (Qiagen). Apply sample to QIAquick column (Qiagen). Centrifuge for 1 minute at 15,000g. Wash with 750 microliters phosphate wash buffer (84.25 mL 95% EtOH + 15.25 mL water + 0.5 mL 1 M KPO4 pH 8.5 solution made by combining 0.5 mL 1M KH2PO4 with 9.5 mL 1M K2HPO4). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters phosphate elution buffer (4 mM KPO4 solution made by diluting 1 M KPO4 pH 8.5 solution). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Dry sample using a speed vac. Resuspend cDNA in 4.5 microliters 0.1 M carbonate buffer (1 M Na2CO3 buffer pH 9.0 diluted 1:10 with water). Allow the sample to resuspend for 15 minutes at room temperature. Add 4.5 microliters NHS-Cy (Amersham) resuspended in 73 microliters DMSO. Incubate for 1 hour at room temperature in the dark. Add 4.5 microliters 4 M hydroxylamine. Incubate for 15 minutes at room temperature in the dark. Add: 35 microliters 100 mM NaOAc pH 5.2; 500 microliters PB buffer. Apply to Qiaquick column. Centrifuge for 1 minute at 15,000g. Wash with 750 microliters PE buffer (Qiagen). Centrifuge for 1 minute at 15,000g. Repeat wash. Empty collection tube and centrifuge for 1 minute at 15,000g. Transfer column to fresh tube. Add 30 microliters EB buffer (Qiagen). Incubate for 1 minute. Centrifuge for 1 minute at 15,000g. Repeat elution for a final volume of 60 microliters. Check quality of probes spectrophotometrically from 200nm to 700nm. Store at -80 degrees C.
Hybridization protocol
Combine Cy3 and Cy5 samples and 1 microliter cy-labeled arabidopsis 70-mer positional controls (This is a pool of 4 70-mers labeled with Cy3 and Cy5 for a total of 8 70-mers at 2 ng/microliter each. The sequences are: At2g14610a_219_rev - AAAAAAATATATCAACAATGGCAAAGCTACCGATACGAAACAATATTAGGAAAAATGTGTGTAAGGACAA; At2g14610b_265_rev - AATTTAAACTGCGTATTAGTGTTTGGAAAAAAAAAACAAAGTGTATACAATGTCAATCGGTGATCTTTTT; At2g14610c_305_rev - TTAATAACATATAATATTGAATAGGATATCATAGGATATTATTACGTAATAATATCCTATGGTGTCATTT; At2g14610d_298_rev - CGACTTTTCTTGCTTAGAAGTCTTTGCATTGTTAATAGATTGTTGAAAAGGTTTATTCATTACTTTCATG). Dry using a speed vac. Make pre-hybridization buffer by combining: 0.5 g BSA; 37 mL DEPC water; 12.5 mL 20X SSC; 0.5 mL 10% SDS. Incubate pre-hybridization buffer for 20 minutes at 42 degrees C. Filter using a 0.45 micrometer cellulose acetate filter into a coplin jar. Incubate for 20 minutes at 42 degrees C. Make hybridization buffer by combining: 500 microliters fomamide; 250 microliters 20X SSC; 10 microliters 10% SDS; 240 microliters DEPC water. Filter hybridization buffer through a 0.45 micrometer cellulose acetate filter. Add 50 uL sheared salmon sperm DNA (Ambion) to hybridization buffer. Add 60 microliters hybridization buffer to speed vac-dried probes. Put slide into pre-hybridization buffer in coplin jar. Incubate for 45 minutes at 42 degrees C. Wash slide 4 times in water and 3 times in isopropanol for 2 minutes per wash with gentle shaking by hand. Dry slide by spinning. Clean 25 mm x 60 mm lifterslip (Erie Scientific Company) by dipping in MilliQ water for 5 minutes at room temperature. Dip in 100% EtOH and dry with a Chem Wipe. Heat probes for 15 minutes at 95 degrees C with occassional "flicking" to resuspend probes. Remove probes from heat block and centrifuge for 2 minutes at 15,000g. Place lifterslip onto slide and add probes by allowing capillary action to pull the probes under the lifterslip. Hybridize overnight at 42 degrees C. Wash slide 2 times in glass staining dish with 1X SSC, 0.2% SDS for 5 minutes at 42 degrees C. Wash slide in 0.1X SSC, 0.1% SDS for 5 minutes at room temperature. Wash slide 3 times in 0.1X SSC for 5 minutes at room temperature. Dry slide by spinning.
Scan protocol
Slide were scanned at 10 micrometer resolution using an Axon 4000B scanner with GenePix 4.0 software.
Description
This slide measures gene expression of Synechococcus sp. WH8102 exposed to copper shock compared to a non-shocked control.
Data processing
Tiff images were processed using TIGR-Spotfinder (www.tigr.org/software) with Otsu thresholding, a minimum spot size of 10 and a maximum spot size of 15, and applying the default quality control filter options. The data were normalized ignoring controls with the LOWESS algorithm in block mode with a smooth parameter of 0.33 by using TIGR-MIDAS (www.tigr.org/software).
