|
| Status |
Public on Jun 01, 2020 |
| Title |
kidney_20m_2_ribo |
| Sample type |
SRA |
| |
|
| Source name |
Kidney
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
age: 20 months
tissue: Kidney
|
| Extracted molecule |
total RNA |
| Extraction protocol |
N2l frozen and stored at -80°C liver and kidney samples of approximate weight of 55 mg and 75 mg respectively were taken for lysis. Tissues were lysed with the same lysis protocol as described in Gerashchenko et al., 2018, bioRxiv. After homogenization and centrifugation 250 µl of lysate were supplied with 20 Units of SUPERase-In RNAse inhibitor and taken for RNA-Seq library preparation, the 500 µl of lysate were brought to 1 ml with lysis buffer and taken for ribosome profiling library preparation.
Ribosome profiling libraries were prepared as described in doi:10.1101/279257 with modification in RNase digestion indicated below. RNA digestion of lysates was performed for 1 hour with mixture of RNase T1 (2000 Units) and RNase S7 (300 Units). After 30 minutes of incubation 0.8 mg of heparin were added to inhibit all RNases except for RNase T1. After digestion lysates were supplied with 80 Units of SUPERase-In RNAse inhibitor. For RNA-Seq total RNA was isolated from 250 µl of lysate with 750 µl of TRIzol LS Reagent and treated with RQ1 RNase-Free DNase (1 Unit for 1 µg of total RNA) for 30 minutes at 37°C with subsequent water saturated acidic phenol extraction and precipitation by the ethanol method (with addition of 1/100 volume of glycogen RNA grade). 500 ng of DNase treated total RNA was depleted of ribosomal RNA with NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (#E6310) and used for transcriptome libraries preparation with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (#E7760).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Ribosome-bound RNA
|
| Data processing |
Library strategy: Ribosome profiling
For the Ribo-Seq data: adapter sequences were cut with cutadapt v1.14 (-a AGATCGGAAGAGCACACGTCT)
For the Ribo-Seq data: the remaining low-quality base calls at the read ends were additionally removed with sickle v1.33.
RNA-Seq data: no special trimming was applied
Read mapping and counting was performed with STAR v2.5.3.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-separated text files containing read counts per gene as estimated by STAR.
|
| |
|
| Submission date |
Dec 17, 2018 |
| Last update date |
Jun 01, 2020 |
| Contact name |
Aleksandra S Anisimova |
| E-mail(s) |
aleksandra.anisimova@univie.ac.at, alessandrick@gmail.com
|
| Organization name |
Max Perutz Labs, Vienna BioCenter, University of Vienna, Medical University of Vienna
|
| Lab |
Karagöz Lab
|
| Street address |
Dr. Bohr Gasse 9
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE123981 |
Age-resolved ribosome profiling and RNA-Seq data of mice liver and kidney samples |
|
| Relations |
| BioSample |
SAMN10604361 |
| SRA |
SRX5145181 |
