|
| Status |
Public on Aug 27, 2019 |
| Title |
1009N skin |
| Sample type |
SRA |
| |
|
| Source name |
skin
|
| Organism |
Felis catus |
| Characteristics |
tissue: Skin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated from tissue by chloroform-isopropanol extraction.
Libraries were prepared using the Illumina TruSeq small RNA sample preparation kit (Illumina, San Diego, CA) for library preparation and size-separation by polyacrylamide gel electrophorese. Library size was determined with the Bioanalyzer 2100 HS-DNA chip and the KAPA biosystem’s library quantification kit, and libraries normalized to 2 nM. Multiplexed samples (6/lane) were sequenced with a 50 cycle v3 sequencing kit on an Illumina HiSeq 3000 sequencer.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Description |
fca_miRWoodsPredictions.gff
|
| Data processing |
cutadapt v1.15 was used for trimming with the options -e 0.2 -m 17 -q 10 -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
fastqQualityFilter.pl within the miRWoods package was used to remove reads with an average quality score less than 30
bowtie v1.2.11 was used with the options -n 1 -e 50 -l 18 -m 10 -a -S --best --strata to map the reads to the genome
addNHTags.pl within the miRWoods package was used to add a tag containing the number of hits to the genome for each read in the sam file
trimMiRReads.pl within the miRWoods package was used for further trimming of mapped reads within the sam file
samtools was used to convert the sam output from bowtie into a bamfile
miRWoods was run in order to predict microRNAs within each set
Gff files were created consisting of the precursor and the products.
Genome_build: Bos Taurus UMD 3.1.1 and Felis cattus 8.0
Supplementary_files_format_and_content: gff3 consisting of predicted microRNAs
|
| |
|
| Submission date |
Jan 17, 2019 |
| Last update date |
Aug 27, 2019 |
| Contact name |
David Anthony Hendrix |
| E-mail(s) |
david.hendrix@oregonstate.edu
|
| Phone |
(541) 737-6224
|
| Organization name |
Oregon State University
|
| Department |
Biochemistry and Biophysics/EECS
|
| Street address |
2011 Ag & Life Sciences Bldg
|
| City |
Corvallis |
| State/province |
OR |
| ZIP/Postal code |
97331 |
| Country |
USA |
| |
|
| Platform ID |
GPL26066 |
| Series (1) |
| GSE125279 |
miRWoods: enhanced precursor detection and stacked random forests for the sensitive detection of microRNAs. |
|
| Relations |
| BioSample |
SAMN10765923 |
| SRA |
SRX5258885 |
