|
Status |
Public on May 01, 2019 |
Title |
Viable_Paternal_excess_1 [miRNA-Seq] |
Sample type |
SRA |
|
|
Source name |
Endosperm
|
Organism |
Arabidopsis thaliana |
Characteristics |
genotype: Ler female x 4N Col nrpd1 male developmental stage: 7 days after pollination
|
Treatment protocol |
no treatment
|
Growth protocol |
Plants were grown in a growth-chamber with 16-hour days at ~21 C. Flowers were emasculated 2 days before pollination. Seeds were dissected at seven days after pollination
|
Extracted molecule |
total RNA |
Extraction protocol |
Seeds from crosses between multiple individuals were hand-dissected and total embryo or endosperm RNA isolated using the Ambion RNAqueous Micro Kit. The small RNA pool was separated from the larger RNA pool by sequential ethanol addition and filtering. The larger RNA pool was collected on filters after the addition of ethanol equivalent to 60% of the sample volume, and the small RNA pool was collected on filters after the addition of ethanol equivalent to 50% of the flowthrough volume from the larger RNA filter binding step. Libraries for Illumina sequencing were constructed using the NEXTflex Small RNA-Seq Kit v3 as directed (Bioo Scientific Corporation, Austin, Texas). Final library amplification was carried out for 24 cycles and the resultant libraries were size selected with a pippin prep. 40 base single-end sequencing of sRNA libraries was performed on an Illumina HiSeq 2500 machine.
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
sRNA-seq
|
Data processing |
Analysis of sRNA libraries began with the trimming of low-quality read ends fastq_quality_trimmer -v -t 20 -l 25; (http://hannonlab.cshl.edu/fastx_toolkit/). Adapters were removed with cutadapt -a TGGAATTCTCGGGTGCCAAGG --trimmed-only --quality-base 64 -m 24 -M 40 --max-n 0.5 (https://cutadapt.readthedocs.io/en/stable/) sRNA libraries prepared using the NEXTflex sRNA-Seq Kit v2 are appended with 4 base randomized barcodes immediately 3’ and 5’ of the sRNA read itself. These barcodes were used to remove PCR duplicates (any read of the same sRNA sequence with identical flanking barcodes on both ends) using prinseq-lite –fastq <infile> -out_format 3 –out_good <outfile> -derep 1 Reads were aligned to TAIR10 using bowtie -v 1 --best -5 4 -3 4 --sam --phred64-quals or --phred33-quals Genome_build: TAIR10 Supplementary_files_format_and_content: un-normalized bedgraph files with 4th column showing read depth at that position. Bedgraph files include reanalysis of data from balanced endosperm previously published by Erdmann etal (2017).
|
|
|
Submission date |
Feb 22, 2019 |
Last update date |
May 02, 2019 |
Contact name |
satyaki P Rajavasireddy |
E-mail(s) |
satyaki@wi.mit.edu
|
Phone |
6072290279
|
Organization name |
Whitehead Institute for Biomedical Research
|
Lab |
Gehring Lab
|
Street address |
455 Main Street
|
City |
Cambridge |
State/province |
Massachusetts |
ZIP/Postal code |
02142 |
Country |
USA |
|
|
Platform ID |
GPL17639 |
Series (2) |
GSE126930 |
Paternally-acting canonical RNA-directed DNA methylation pathway genes sensitizes Arabidopsis endosperm to paternal dosage [miRNA-Seq] |
GSE126932 |
Paternally-acting canonical RNA-directed DNA methylation pathway genes sensitizes Arabidopsis endosperm to paternal dosage |
|
Relations |
BioSample |
SAMN10987543 |
SRA |
SRX5408228 |