 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 12, 2019 |
| Title |
RNAseq-K63855-Testis-Batch2-rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Testis
|
| Organism |
Phascolarctos cinereus |
| Characteristics |
tissue: Testis
source: Gold Coast, Australia
koala id: K63855
developmental stage: adult
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA samples were treated with Turbo DNase (Invitrogen) and RNA cleanup was done following manufacturer’s instructions using the RNeasy Mini Kit (Qiagen).
Strand-specific RNA sequencing libraries for K63855 testis replicate 1, K63855 testis replicate 2 and K63464 testis replicate 2 were prepared as described in (Zhang Z, Theurkauf WE, Weng Z, Zamore PD. Strand-specific libraries for high throughput RNA sequencing (RNA-Seq) prepared without poly(A) selection. Silence. 2012;3(1):9. Published 2012 Dec 28. doi:10.1186/1758-907X-3-90). In brief, total RNA was isolated from frozen koala tissue samples via the mirVana miRNA Isolation kit and then rRNA depleted using the RiboZeroâ„¢ Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). RNAs greater than 200nt were selectively recovered using the RNA Clean & Concentrator-5 kit(Zymo Research). RNA samples were fragmented and reverse transcribed. dUTP was incorportated during second strand synthesis for strand specificity. End repair and A-tailing was performed followed by adapter ligation and uracil-DNA glycosylase (UDG) treatment. Finally, the library was PCR amplified.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
DNA sequencing raw reads were mapped to genome using BWA mem (version 0.7.12-r1044) allowing soft clipping. Mapped sam format results were transformed into sorted bam format via samtools (version 1.8). Then modified TEMP are used for new transposon insertion and transposon absence detecting.
RNA sequencing raw reads were mapped to genome using STAR (version 020201) after removing rRNA via bowtie2 with default parameters (version 2.2.5). Mapped sam format results were transformed into sorted and duplication removed bam format via samtools (version 1.8). Final mapped reads were assigned into protein-coding genes, non-coding RNAs and piRNA genes via HTSeq (version 0.9.1) and then reads per million unique mapped reads in per thousand nucleotide (RPKM) was calculated using custom bash scripts. rRNA removed RNA sequencing reads were also mapped to transposon consensus sequences directly using Hisat2 (version 2.1.0) with default parameters. Then transposon expression levels were calculated via Bedtools (version 2.27.1).
The adapter (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGT) of small RNA sequencing raw reads were first removed via cutadapt (version 1.15). Then reads with rRNA, miRNA, snoRNA, snRNA and tRNA filtered were mapped to genome and transposon consensus sequences independently via Bowtie (version 1.1.0). piRNA reads per million genome mapping reads (PPM) of piRNA clusters and transposons were calculated for unoxidized and oxidized samples.
Genome_build: phaCin_unsw_v4.1
Supplementary_files_format_and_content: TXT
|
| |
|
| Submission date |
Mar 11, 2019 |
| Last update date |
Oct 14, 2019 |
| Contact name |
Tianxiong Yu |
| Organization name |
Umass Med
|
| Street address |
364 Plantation St
|
| City |
Worcester |
| State/province |
MA |
| ZIP/Postal code |
01605 |
| Country |
USA |
| |
|
| Platform ID |
GPL24665 |
| Series (1) |
| GSE128122 |
The piRNA Response to Retroviral Invasion of the Koala Genome |
|
| Relations |
| BioSample |
SAMN11099809 |
| SRA |
SRX5503557 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3665259_K63855-Testis-batch2-rep1_longRNAabundance.txt.gz |
199.5 Kb |
(ftp)(http) |
TXT |
| GSM3665259_K63855-Testis-batch2-rep1_transposon_longRNAabundance.txt.gz |
4.1 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
