 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 12, 2019 |
| Title |
smallRNA-K63855-Liver-unoxidized |
| Sample type |
SRA |
| |
|
| Source name |
Liver
|
| Organism |
Phascolarctos cinereus |
| Characteristics |
tissue: Liver
source: Gold Coast, Australia
koala id: K63855
developmental stage: adult
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA samples were treated with Turbo DNase (Invitrogen) and RNA cleanup was done following manufacturer’s instructions using the RNeasy Mini Kit (Qiagen).
Small RNA sequencing libraries were prepared as previously described (Li, C., Vagin, V.V., Lee, S., Xu, J., Ma, S., Xi, H., Seitz, H., Horwich, M.D., Syrzycka, M., Honda, B.M., et al. (2009). Collapse of germline piRNAs in the absence of Argonaute3 reveals somatic piRNAs in flies. Cell 137, 509–521.). Briefly, total RNA was isolated from flash frozen koala tissue using the mirVana miRNA Isolation Kit (Ambion/Life Technologies). Small RNAs were sized selected and purified from a 15% denaturing polyacrylamide-urea gel using the ZR small-RNA™ PAGE Recovery Kit (Zymo Research). For oxidized RNA library preparations, purified RNA was oxidized with 25 mM NaIO4 in 30 mM borax, 30 mM boric acid, pH 8.6, for 30 min at room temperature followed by ethanol precipitation. 3′ pre-adenylated adapter was ligated to oxidized or un-oxidized small RNAs. The 3´ ligated product was purified from a 15% denaturing polyacrylamide-urea gel. 5′ RNA adapter ligation was performed and the ligated product was purified from a 10% denaturing polyacrylamide-urea gel and used to synthesize cDNA. The resulting cDNA was PCR amplified and run on a 2% Certified Low Range Ultra Agarose (Bio-Rad) gel with subsequent extraction using the QIAquick® Gel Extraction Kit (Qiagen).
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
DNA sequencing raw reads were mapped to genome using BWA mem (version 0.7.12-r1044) allowing soft clipping. Mapped sam format results were transformed into sorted bam format via samtools (version 1.8). Then modified TEMP are used for new transposon insertion and transposon absence detecting.
RNA sequencing raw reads were mapped to genome using STAR (version 020201) after removing rRNA via bowtie2 with default parameters (version 2.2.5). Mapped sam format results were transformed into sorted and duplication removed bam format via samtools (version 1.8). Final mapped reads were assigned into protein-coding genes, non-coding RNAs and piRNA genes via HTSeq (version 0.9.1) and then reads per million unique mapped reads in per thousand nucleotide (RPKM) was calculated using custom bash scripts. rRNA removed RNA sequencing reads were also mapped to transposon consensus sequences directly using Hisat2 (version 2.1.0) with default parameters. Then transposon expression levels were calculated via Bedtools (version 2.27.1).
The adapter (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGT) of small RNA sequencing raw reads were first removed via cutadapt (version 1.15). Then reads with rRNA, miRNA, snoRNA, snRNA and tRNA filtered were mapped to genome and transposon consensus sequences independently via Bowtie (version 1.1.0). piRNA reads per million genome mapping reads (PPM) of piRNA clusters and transposons were calculated for unoxidized and oxidized samples.
Genome_build: phaCin_unsw_v4.1
Supplementary_files_format_and_content: TXT
|
| |
|
| Submission date |
Mar 11, 2019 |
| Last update date |
Oct 14, 2019 |
| Contact name |
Tianxiong Yu |
| Organization name |
Umass Med
|
| Street address |
364 Plantation St
|
| City |
Worcester |
| State/province |
MA |
| ZIP/Postal code |
01605 |
| Country |
USA |
| |
|
| Platform ID |
GPL24665 |
| Series (1) |
| GSE128122 |
The piRNA Response to Retroviral Invasion of the Koala Genome |
|
| Relations |
| BioSample |
SAMN11099801 |
| SRA |
SRX5503565 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3665267_K63855-Liver-unox.piRNAInCluster.txt.gz |
15.3 Kb |
(ftp)(http) |
TXT |
| GSM3665267_K63855-Liver-unox.piRNAInTransposon.txt.gz |
6.4 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
