|
Status |
Public on Oct 01, 2019 |
Title |
ANG KO Clone5 SA1 |
Sample type |
SRA |
|
|
Source name |
U2OS ANG KO sodium arsenite
|
Organism |
Homo sapiens |
Characteristics |
cell line: U2OS genotype: ANG -/-
|
Treatment protocol |
For sodium arsenite treatment, U2OS cells were grown to ~80% confluency and replaced with fresh media, supplemented with 1 mM (final concentration in water) sodium arsenite (Sigma #S7400) in CO2 incubator at 37 °C for 1 hour.
|
Growth protocol |
HEK293T and U2OS cells were obtained from ATCC and maintained in HyClone Dulbecco’s High Glucose Modified Eagles Medium (GE #SH30081.01) with 10% FBS.
|
Extracted molecule |
total RNA |
Extraction protocol |
Cells were grown to ~80% confluency and washed briefly twice with ice-cold PBS. Total RNA was extracted by Trizol reagent (Invitrogen #15596018) and purified with column-based Direct-zol RNA Miniprep kit (Zymo Research #R2051). Small RNA-sequencing libraries were prepared following NEBNext Small RNA library kit (NEB #E7300). Briefly, 1 μg total RNA was ligated with 3’ pre-adenylated adaptors and then 5’ adaptors. After reverse transcription and PCR amplification with indexed-adaptors, each library was size selected on 8% TBE-PAGE gel (Invitrogen #EC6215BOX) to enrich for 15-50 nt insert.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
cutadapt v1.15 (--nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 15) STAR aligner v2.5.4 unitas v1.7.3 (–species_miR_only –species homo_sapiens) Genome_build: hg38 Supplementary_files_format_and_content: unitas tRF count table: tRNA fragments count table grouped by tRF types and parental tRNAs, generated by unitas
|
|
|
Submission date |
May 06, 2019 |
Last update date |
Oct 03, 2019 |
Contact name |
Anindya Dutta |
E-mail(s) |
ad8q@virginia.edu
|
Organization name |
University of Virginia
|
Department |
Department of Biochemistry and Molecular Genetics
|
Street address |
1340 Jefferson Park Ave
|
City |
Charlottesville |
State/province |
VA |
ZIP/Postal code |
22901 |
Country |
USA |
|
|
Platform ID |
GPL18573 |
Series (1) |
GSE130764 |
Human ANGIOGENIN is sufficient but not required for tRNA cleavage to generate tRNA fragments |
|
Relations |
BioSample |
SAMN11582034 |
SRA |
SRX5796623 |