|
| Status |
Public on Oct 01, 2019 |
| Title |
ANG KO Clone5 SA1 |
| Sample type |
SRA |
| |
|
| Source name |
U2OS ANG KO sodium arsenite
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: U2OS
genotype: ANG -/-
|
| Treatment protocol |
For sodium arsenite treatment, U2OS cells were grown to ~80% confluency and replaced with fresh media, supplemented with 1 mM (final concentration in water) sodium arsenite (Sigma #S7400) in CO2 incubator at 37 °C for 1 hour.
|
| Growth protocol |
HEK293T and U2OS cells were obtained from ATCC and maintained in HyClone Dulbecco’s High Glucose Modified Eagles Medium (GE #SH30081.01) with 10% FBS.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were grown to ~80% confluency and washed briefly twice with ice-cold PBS. Total RNA was extracted by Trizol reagent (Invitrogen #15596018) and purified with column-based Direct-zol RNA Miniprep kit (Zymo Research #R2051).
Small RNA-sequencing libraries were prepared following NEBNext Small RNA library kit (NEB #E7300). Briefly, 1 μg total RNA was ligated with 3’ pre-adenylated adaptors and then 5’ adaptors. After reverse transcription and PCR amplification with indexed-adaptors, each library was size selected on 8% TBE-PAGE gel (Invitrogen #EC6215BOX) to enrich for 15-50 nt insert.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
cutadapt v1.15 (--nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 15)
STAR aligner v2.5.4
unitas v1.7.3 (–species_miR_only –species homo_sapiens)
Genome_build: hg38
Supplementary_files_format_and_content: unitas tRF count table: tRNA fragments count table grouped by tRF types and parental tRNAs, generated by unitas
|
| |
|
| Submission date |
May 06, 2019 |
| Last update date |
Oct 03, 2019 |
| Contact name |
Anindya Dutta |
| E-mail(s) |
ad8q@virginia.edu
|
| Organization name |
University of Virginia
|
| Department |
Department of Biochemistry and Molecular Genetics
|
| Street address |
1340 Jefferson Park Ave
|
| City |
Charlottesville |
| State/province |
VA |
| ZIP/Postal code |
22901 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE130764 |
Human ANGIOGENIN is sufficient but not required for tRNA cleavage to generate tRNA fragments |
|
| Relations |
| BioSample |
SAMN11582034 |
| SRA |
SRX5796623 |
