|
Status |
Public on Feb 27, 2020 |
Title |
Bcell_ATACSeq_Spt5dep2_48857 |
Sample type |
SRA |
|
|
Source name |
primary activated splenic B lymphocytes
|
Organism |
Mus musculus |
Characteristics |
cell type: Supt5hFl/- Rosa26ERT2-cre/+ primary mature B cells treatment: 4-hydroxy tamoxifen (4-HT)
|
Treatment protocol |
Primary acttivated B cells were activated for 28h prior to the addition of 2 mM 4-HT for 32h (total of 60h B cell activation with 32h 4-HT treatment) and then harvested for all downstream applications.
|
Growth protocol |
Primary mature B cells were isolated from spleens of Supt5hFl/-Rosa26ERT2-cre/+ and Rosa26ERT2-cre/+ mice and cultured in complete RPMI medium wit IL4/LPS stimulation.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
ATAC-seq was performed as previously described (Buenrostro et al., 2013) with minor modifocations in the tagmentation step where we used a homemade Tn5 enzyme and assembeld the Tn5-adapter tagmentation mix ourselves. However, the adapter sequences and primers used for library amplification are the same as in the Buenrostro et al. protocol. transposed DNA was amplified with RT-qPCR monitoring to avoid oveamplification and the libraries were purified with AMPure XP beads.
|
|
|
Library strategy |
ATAC-seq |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
The illumina reads were adapter trimmed on their 3’ ends with cutadapt (version 1.15; --match-read-wildcards -O 1 -f fastq -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC for read1 and cutadapt --match-read-wildcards -O 1 -f fastq -a CTGTCTCTTATACACATCTGACGCTGCCGACGA for read2). The paired end trimmed reads larger then 18nt were aligned with bowtie2 (version 2.1.0; --sensitive -p 10 -X 5000 -N 0 --trim5 0 --trim3 0) to the mouse mm9 genome. The aligned reads were sorted by position with samtools (version 0.1.19). Strand specific and undirected occupancy profiles were generated with deeptools bamCoverage v2.2.2. Genome_build: NCBI mm9 Supplementary_files_format_and_content: bigWig of rpm-normalized read densities
|
|
|
Submission date |
May 31, 2019 |
Last update date |
Feb 27, 2020 |
Contact name |
Tobias Neumann |
Organization name |
IMP
|
Street address |
Campus-Vienna-Biocenter 1
|
City |
Vienna |
ZIP/Postal code |
1030 |
Country |
Austria |
|
|
Platform ID |
GPL17021 |
Series (1) |
GSE132029 |
Regulation of enhancer transcription by Spt5 directly couples enhancer activation with enhancer function |
|
Relations |
BioSample |
SAMN11909934 |
SRA |
SRX5938672 |