|
| Status |
Public on Aug 12, 2019 |
| Title |
E6 chicken lung rep1 |
| Sample type |
SRA |
| |
|
| Source name |
embryonic chick lung
|
| Organism |
Gallus gallus |
| Characteristics |
breed: White Leghorn
genotype: wildtype
age: embryonic E6
|
| Growth protocol |
embryonic chicken lungs were isolated from embryos at E5 and E6 for RNA extraction
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated from a pool of 6 embryonic chicken lungs isolated from E5 and E6 chcicken embryos using QIAGEN Rneasy fibrous tissue kit.
PrepX RNA-Seq for Illumina Library Kit, from WaferGen
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
1. Basecalls performed by Illumina RTA version 1.18.64.0
2. PhiX removal using alignment with Bowtie version 1.1.1
3. Demulitiplexing performed by Galaxy's Enhanced Barcode Splitter v 1.1
4. Illumina TruSeq Adapters (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) trimmed with Cutadapt (Galaxy version 1.6) with default parameters
5. Alignment to mm10 genome using Tophat (Galaxy version 0.9) with the following settings: --library_type (first-strand), --GTF (UCSC mm10 GTF file), --no-novel-juncs
6. Gene counts generated using htseq-count (Galaxy version 0.6.1galaxy1) with default parameters
7. Differential expression analysis performed using DESeq2 (Galaxy Version 2.1.8.3)
* Step 3 produced the raw data files below
* Step 6 produced the raw count files that were fed into the differential expression analysis with DESeq2 via Galaxy (DESeq2 Galaxy Wrapper version 2.1.8.3) which uses DESeq2 version 1.8.2 ( R version 3.2.1 (2015-06-18) -- "World-Famous Astronaut", DESeq2 version 1.8.2)
* Step 7 produced the lists of fold change and p-values (another possible "processed data file")
Genome_build: Galgal4
|
| |
|
| Submission date |
Jun 10, 2019 |
| Last update date |
Aug 12, 2019 |
| Contact name |
Celeste M Nelson |
| E-mail(s) |
celesten@princeton.edu
|
| Phone |
609-258-8851
|
| Organization name |
Princeton University
|
| Department |
Chemical & Biological Engineering
|
| Street address |
303 Hoyt Laboratory
|
| City |
Princeton |
| State/province |
NJ |
| ZIP/Postal code |
08540 |
| Country |
USA |
| |
|
| Platform ID |
GPL19005 |
| Series (1) |
| GSE132478 |
Mesenchymal proteases and tissue fluidity remodel the extracellular matrix during airway epithelial branching in the embryonic avian lung |
|
| Relations |
| BioSample |
SAMN12006942 |
| SRA |
SRX6003207 |
