 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 16, 2019 |
| Title |
zikv5 |
| Sample type |
SRA |
| |
|
| Source name |
blastocyst
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
tissue: single blastocyst
developmental stage: E3.5
treatment: ZIKV, MR766
|
| Treatment protocol |
E3.5 embryos were flushed, zona pellucidas were removed, and blastocysts were treated with MOCK or Zika virus (MR766) for 24 hours in hanging drops
|
| Growth protocol |
C57BL/6 females were plugged by C57BL/6 males
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Embryos were washed with several drops of media and PBS, and processed as in Poulain, S. et al., . Methods Mol Biol, 2017 PMID: 28349422. In short, embryos were lysed in 5 ul lysis buffer containing an RT primer (TCGTCGGCAGCGTCAGATGTGNNNNNN).
Samples were then reverse transcribed in a 20 ul RT reaction containing a template-switching oligo (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNTATA(rG)(rG)(rG)). Pre-amplification PCR was performed using a PCR primer (TCGTCGGCAGCGTCAGATGTG). The concentration of the resulting cDNA libraries was measured with Qubit® 2.0 Fluorometer (ThermoFisher Scientific) and library preparation was performed with the Nextera XT Library Preparation Kit (Illumina, Cat. FC-131-1096), followed by library fragment size validation with BioAnalyzer (Agilent Technologies).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
zikv5
|
| Data processing |
Illumina bcl2fastq2 v2.19 was used for basecalling.
Sequenced reads were trimmed for low-quality bases and for adapter sequences using cutadapt; then mapped to the mouse mm10 reference genome using STAR v2.5.2b.
Read counts were calculated using HTSeq-count v0.6.1. Differential expression analysis was performed using DESeq2 package v1.6.3.
Genome_build: mm10
Supplementary_files_format_and_content: excel file including gene name, Ensembl id and normalized expression (regularized-logarithm transformation) of each gene in each sample
|
| |
|
| Submission date |
Jun 25, 2019 |
| Last update date |
Aug 16, 2019 |
| Contact name |
Shuibing Chen |
| E-mail(s) |
shuibing.chen@gmail.com
|
| Phone |
2127465431
|
| Organization name |
Weill Cornell Medical College
|
| Department |
Surgery
|
| Street address |
A 827B, 1300 York Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL21103 |
| Series (1) |
| GSE133254 |
Effect of ZIKV on pre-implantation embryos |
|
| Relations |
| BioSample |
SAMN12130937 |
| SRA |
SRX6358966 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
