|
| Status |
Public on Oct 05, 2020 |
| Title |
CTCF_Growing_2 |
| Sample type |
SRA |
| |
|
| Source name |
IMR90
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: IMR90
vector: ER:HRAS(G12V)
4oht: No
chip antibody: CTCF (D31H2, CST 3418)
passage: 20-25
|
| Treatment protocol |
For RIS samples,IMR90 ER:HRAS(G12V) cells were treated for 6 days with 100nM 4OHT.
|
| Growth protocol |
IMR90 and WI38 cells (ATCC) were cultured in DMEM supplemented with 10% FBS. Cells were maintained in physiological 5% O2.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Fixed cells were lysed and sonicated to generate 200-400 bp chromatin fragments before immunoprecipitation.
Libraries were prepared using the NEBnext ultra II DNA-library prep kit for Illumina (E7645) according to manufacturers instructions except that size selection was performed during the final bead purification step using SPRIselect beads (B23319, Beckman Coulter)
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
CTCF Growing Replicate 2
|
| Data processing |
Fastq files were quality checked using FastQC [Babraham Institute, Simon Andrews], trimmed using cutadapt 2.0 [https://doi.org/10.14806/ej.17.1.200] with -m 20 --match-read-wildcards -q 28,28 -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (paired-end experiments were trimmed simultaneously).
Reads were aligned with bowtie2 [Langmead and Salzberg 2012, Nature Methods] using default parameters and samtools [Li et al. 2009, Bioinformatics] was used for selecting only uniquely mapping reads and removing duplicates.
Alignment files corresponding to multiple lanes were merged using samtools [Li et al. 2009, Bioinformatics].
Peak calling was performed using macs2 [Zhang et al 2008, Genome Biology] in two stages, one with default parameters and one with insert sizes calculated using ChIPQC [Caroll et al. Frontiers in Genetics and R Bioconductor].
BigWig files were obtained by using THOR [Alhoff et al. 2016, Nucleic Acids Research] which performs input subtraction and library normalisation, as well as differential binding analysis.
Genome_build: hg19
Supplementary_files_format_and_content: bigWig (THOR-normalised signal with Input subtracted)
|
| |
|
| Submission date |
Jul 30, 2019 |
| Last update date |
Oct 05, 2020 |
| Contact name |
Ioana Olan |
| E-mail(s) |
Ioana.Olan@cruk.cam.ac.uk
|
| Organization name |
University of Cambridge
|
| Department |
Cancer Research UK Cambridge Institute
|
| Lab |
Narita Lab
|
| Street address |
Robinson Way
|
| City |
Cambridge |
| State/province |
Cambridgeshire |
| ZIP/Postal code |
CB2 0RE |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE135088 |
Transcription-driven cohesin accumulation is associated with secretory phenotype of senescence [ChIP-Seq] |
| GSE135093 |
Transcription-driven cohesin accumulation is associated with secretory phenotype of senescence |
|
| Relations |
| SRA |
SRX6614732 |
| BioSample |
SAMN12414264 |
