 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 16, 2019 |
| Title |
Rice total RNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
rice leaves
|
| Organism |
Oryza sativa |
| Characteristics |
tissue: rice leaves
treatment: none
assay: total RNA-seq (rRNA depleted)
genome build: IRGSP-1.0
library id: JHS610
assayed molecule: total RNA
library strategy: total RNA-seq
|
| Extracted molecule |
total RNA |
| Extraction protocol |
K562 cells were grown in RPMI1640+L‐Glutamine with heat inactivated 10% FBS (Biowest Cat No.S1620, Lot 61N16) and 1x Pen/Strep (Gibco15140-163) and 1x L-Glutamine (Gibco25030164) in T75 flasks at 37°C with 5% CO2. HCT116 CMV-osTIR1 RAD21-mAC cells were obtained from Masato T. Kanemaki (Natsume et al., 2016) and cultured in McCoy’s 5A medium supplemented with 10% FBS. Cells were washed twice in 1x cold PBS (Gibco 10010023) and RNA isolated using Trizol LS. Human H9 cell RNA was provided by Yuanyuan Li and Mark H. Tuszynski (UC San Diego). H9 cells were grown as described in (Lu et al. 2017) and RNA isolated using the Qiagen RNA kit. Murine BMDMs were isolated, cultured and RNA extracted as described (Link et al. 2018). Nematostella vectensis (planula stage) was kindly provided by Drs. James Gahan and Fabian Rentzsch (University of Bergen). Neurospora crassa was provided by Dr. Jason Stajich (University of California, Riverside) and grown in Vogels media under constant light and gentle agitation (Wang et al. 2015). Rice was grown in the SALK greenhouse with 12 h light and leaves from adult plants provided by Dr. Joanne Chory (Salk Institute for Biological Studies). All non-mammalian samples were flash frozen in liquid N2, pulverized with a mortar and pestle and RNA extracted using Trizol LS as described by the manufacturer. Capsaspora owczarzaki RNA (Sebé-Pedrós et al. 2016) was gifted by Dr. Iñaki Ruiz-Trillo (Institut de Biologia Evolutiva; CSIC-Universitat Pompeu Fabra).
Small RNAs of ~20-60 nt were size selected form 2-15 µg of total RNA by denaturing gel electrophoresis. A 10% input sample was taken aside and the remainder enriched for 5’Caped RNAs with 3’-OH. Monophosphorylated RNAs were selectively degraded by Terminator 5´-Phosphate-Dependent Exonuclease (Lucigen). Subsequent 5’dephosporylation by CIP (NEB) followed by decapping with RppH (NEB) augments Cap-specific 5’adapter ligation by T4 RNA ligase 1 (NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments. Following cDNA synthesis, libraries were amplified for 12-14 cycles and sequenced SE75 on the Illumina NextSeq500. Strand-specific total RNA-seq libraries from ribosomal RNA-depleted RNA were prepared using the TruSeq kit Stranded Total RNA Library kit (Illumina) and sequenced PE100 on Illumina HiSeq 2500. A comprehensive description of the csRNA-seq method and analysis software can be found in the supplement as well as under http://homer.ucsd.edu/homer/ngs/csRNAseq/.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
total RNA-seq in rice leaves (ribozero)
|
| Data processing |
Adapter sequences were first removed from the 3' end of reads for csRNA-seq and small RNA-seq libraries (AGATCGGAAGAGCACACGTCT). Reads were then aligned to the appropriate genome using HISAT2 (v2.1.0) with default settings. Normalized, single nucleotide resolution bigWig files and TSS cluster calls were generated using HOMER's makeUCSCfile and findcsRNATSS.pl tools, respectively (v4.11). findcsRNATSS.pl uses small RNA sequencing and total RNA-seq data as controls to remove non-TSS artifacts in the csRNA-seq data when identifying TSS clusters. http://homer.ucsd.edu/homer/ngs/csRNAseq/
Genome_build: hg38, mm10, ASM20922v1, NC12, IRGSP-1.0, C_owczarzaki_V2
Supplementary_files_format_and_content: BigWig files (.bigWig/.bw) were generated by constructing normalized, single-nucleotide resolution bedGraph files based on 5' read positions using HOMER and converted to bigWigs using UCSC's bedGraphToBigWig utility. TSS text files contain TSS cluster positions defined using HOMER's findcsRNATSS.pl command (tab-delimited text files).
|
| |
|
| Submission date |
Aug 07, 2019 |
| Last update date |
Sep 16, 2019 |
| Contact name |
Christopher Benner |
| E-mail(s) |
cbenner@ucsd.edu
|
| Organization name |
University of California, San Diego (UCSD)
|
| Department |
Medicine
|
| Street address |
9500 Gilman Dr. MC 0640
|
| City |
La Jolla |
| State/province |
California |
| ZIP/Postal code |
92093-0640 |
| Country |
USA |
| |
|
| Platform ID |
GPL23013 |
| Series (1) |
| GSE135498 |
Sequencing short capped RNAs captures acute transcription initiation and identifies promoter and distal regulatory elements across eukaryotes from total RNA |
|
| Relations |
| BioSample |
SAMN12518135 |
| SRA |
SRX6665930 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
