 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 24, 2019 |
| Title |
EN_10m_1 |
| Sample type |
SRA |
| |
|
| Source name |
endometrium
|
| Organism |
Equus caballus |
| Characteristics |
Sex: Female
tissue: Endometrium of placenta
gestational age: 10m
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Isolation of RNA from tissue was performed using RNeasy Mini Kit (Qiagen, Gaithersburg, MD, USA), per manufacturer’s instructions. After extraction, RNA was analyzed by NanoDrop® (Thermo Fisher Scientific) and Bioanalyzer® (Agilent, Santa Clara, CA, USA) to evaluate concentration, purity and integrity. All samples had a 230/260 ratio > 1.8, a 260/280 ratio > 2.0 and an RNA integrity number > 8.0.
Library preparation was performed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina), per manufacturer’s instructions. The adapter for Read 1 was AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG, with NNNNNN signifying the index sequence. The read 2 adapter was AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT. All reads were quantified with qPCR. Sequencing was performed on a HiSeq 4000 (Illumina) using a HiSeq 4000 sequencing kit version 1, generating 150 bp paired-end reads (University of Illinois Roy J. Carver Biotechnology Center). FASTQ files were generated and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
processed data file: processed_data.xlsx
|
| Data processing |
The sequencing results were initially trimmed for adapters and quality using TrimGalore Version 0.4.4 (Babraham Bioinformatics; www.bioinformatics.babraham.ac.uk).
Mapped to EquCab3.0 using STAR-2.5.2b (github.com/alexdobin/STAR).
Cufflinks-2.2.1 (cole-trapnell-lab.github.io/cufflinks/) was used to quantify data in fragments per kilobase/million (FPKM), with the Equus_caballus_Ensembl_95 gtf file used for annotation (-G).
Genome_build: EquCab3.0
Supplementary_files_format_and_content: processed_data.xlsx: Excel file includes FPKM values.
|
| |
|
| Submission date |
Aug 30, 2019 |
| Last update date |
Oct 24, 2019 |
| Contact name |
Shavahn C Loux |
| E-mail(s) |
Shavahn.Loux@uky.edu
|
| Organization name |
University of Kentucky
|
| Department |
Veterinary Science
|
| Street address |
1400 Nicholasville
|
| City |
Lexington |
| State/province |
KY |
| ZIP/Postal code |
40546 |
| Country |
USA |
| |
|
| Platform ID |
GPL24409 |
| Series (1) |
| GSE136691 |
Characterization of the Placental Transcriptome through Mid to Late Gestation in the Mare |
|
| Relations |
| BioSample |
SAMN12662418 |
| SRA |
SRX6784246 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
